10. Using the following DNA template strand sequence, answer the questions that follow. (10)5′-…GCATCCTTTCACAGCAGTGACCAT 3′
10a. What is the complementary DNA strand sequence? (Use only the template sequence in
bold letters.)
5′ AAAGTGTCGTCACTGGTA
106. Now write down the sequence of the corresponding m-RNA. (Use only the template
sequence in bold letters.)
Biology 204: Principles of Biology I (Rev. C8)
Assignment 4 A
AAAGUGUCGUCACUGGUA
10c. What is the sequence of amino acids in the peptide produced?
AAA-GUG-UCG-UCA-CUG-GUA, and the the corresponding amino acid sequence is lys-
val-ser-ser-leu-va
Suppose the DNA sequence becomes mutated and cytosine is inserted before position 11 on
the template strand (for orientation, TTT occupy positions 1, 2 and 3 respectively).
10d. Write down the sequence of the mutated DNA, the sequence of the corresponding m-
RNA and the resulting peptide that is produced as a result of the mutation. (Hint: the
start codon remains intact.)
The mutated sequence is AAAGUGUCGUCGACUGGUA and would translate to the
polypeptide chain !ys-val-ser-ser-thr-gly.
10e. What kind of a mutation is this?
This form of mutation is called a frameshift mutation. A frameshift mutation is when
base pair is added or deleted in the coding sequence, which alters the reading frame of
mRNA.
Order an Essay Now & Get These Features For Free:
Turnitin Report
Formatting
Title Page
Citation
Outline
