Pand Siandani Bwana Environmental and Industrial Biotechnology Paper

Rapid PopulationIdentification Using 16S
rDNA Denaturing Gradient
Gel Electrophoresis (DGGE)
Dr Tim Aldsworth
The University of Nottingham
Dr Tim Aldsworth
• The problem with studying
microbial populations
• DGGE the technique
• Applications of DGGE
• How we have used DGGE
The University of Nottingham
Dr Tim Aldsworth
Population Problems
• Estimate less than 20% of total
microorganisms isolated and
characterised (Wayne et al; 1987)
• Traditional isolation and
identification techniques are
cumbersome:
– Preenrichment
– Enrichment
– Selective medium
– Confirmation
• Is there a rapid alternative?
The University of Nottingham
Dr Tim Aldsworth
DGGE the Technique
• How does DGGE
work?
• DGGE relies on the
different Tm of G:C
versus A:T
– G:C has 3 H-bonds
whilst A:T has 2
– G:C requires more
energy/ denaturant to melt
The University of Nottingham
Dr Tim Aldsworth
Fischer and Lerman (1979)
Cell 16:191-200
DGGE the Technique
• How does DGGE work?
– A target sequence in the population
is amplified by PCR
– For global populations, tend to use
16S rDNA as the target
– Use primers for the 16S conserved
region to amplify variable regions
– A G:C clamp is introduced to
prevent the DNA from melting
completely
The University of Nottingham
Dr Tim Aldsworth
DGGE the Technique
• How does DGGE work?
– PCR products separated by gel
electrophoresis
– Gel is cast with a
denaturant gradient
to melt the
amplimers
– Usually a mix of
urea and formamide
The University of Nottingham
Dr Tim Aldsworth
DGGE the Technique
• How does DGGE work?
Increasing
denaturant
concentration
Electrophoresis
direction
AT rich
C
GC rich
The University of Nottingham
Dr Tim Aldsworth
A
G
GC
GC
GC
T
C
G
DGGE the Technique
• How does
DGGE work?
The University of Nottingham
Dr Tim Aldsworth
AT rich
GC rich
Electrophoresis
direction
• Perpendicular
gradient used to
optimise
denaturant
conditions
Increasing denaturant
concentration
DGGE the Technique
• How does DGGE work?
– Gels are stained with GelRed
– Stained gels are viewed under UV
– To identify individual species,
reference strains can also be run in
other lanes, DNA probes can be
applied or bands can be excised
and sequenced
The University of Nottingham
Dr Tim Aldsworth
Cheese
Population Study
• Population Dynamics of
Maturing Cheese
• Why?
• Microbiologically
and chemically
complex starting
material
• Particularly so
for raw milk
cheeses
The University of Nottingham
Dr Tim Aldsworth
Cheese
Population Study
• Batch standardisation
important to customers and
manufacturers
• Question:
• What happens to
the microflora of
raw milk cheeses?
The University of Nottingham
Dr Tim Aldsworth
Cheese
Population Study
• Problem:
• Microflora complexity/
culturability
• Potential solution:
• Denaturing
Gradient
Gel Electrophoresis
The University of Nottingham
Dr Tim Aldsworth
Cheese
Population Study
??
?
?
?
?
?
3
4
5
6
7
=
=
=
=
=
?
?
?
?
?
The University of Nottingham
Dr Tim Aldsworth
1
2
3 4
5
6
7
Cheese
Population Study
References
Lb. plantarum
Staph. aureus
Ent. faecalis
Strep.
thermophilus
Lac. lactis
3 = milk
4 = whey
5 = unsalted curd interior
6 = unsalted curd
exterior
7=
6
The University of Nottingham
Dr Tim Aldsworth
1
2
3 4
5
6
7
Cheese
Population Study
Reference Exterior Interior
Staph. aureus
Ent. faecalis
Lac. lactis
Probable
Strep.
thermophilus
The University of Nottingham
Dr Tim Aldsworth
Milk
Cheese
Population Study
2
3
4
5
6
7
8
=
=
=
=
=
=
=
6 mo interior
3 mo interior
2 mo exterior
2 mo exterior
3 mo exterior
6 mo exterior
freeze-dried starter
a Lb. plantarum
b Staph. aureus
c Ent. faecalis
d Lac. lactis
e Strep.
The University thermophilus
of Nottingham
Dr Tim Aldsworth
Maturing Cheese
1 2
3 4
5 6
7
Refs
8
9 10
a
b
c
d
e
Acknowledgements
• Ms. Helen Davies
• Prof. Chris Dodd
• Mr. Konstantinos Gkatzionis
• Society for General
Microbiology
• Ram Hall dairy
The University of Nottingham
Dr Tim Aldsworth
Appendix – Applications of DGGE
• Example DGGE applications
• To study environmental microbial
ecology
• To study gut microbial ecology during
disease
• To study the microflora of Stilton
cheese
The University of Nottingham
Dr Tim Aldsworth
Appendix – Applications of DGGE
• To study environmental microbial
ecology
• Developed 16S rDNA DGGE
• Separated 5 different species of
bacteria – E. coli, Desulfovibrio
desulfuricans, D. sapovorans,
Thiobacillus thioparus and Microcoleus
chthonoplastes
• By probing could demonstrate
anaerobic bacteria in aerobic biofilm
The University of Nottingham
Dr Tim Aldsworth
Muyzer et al. (1993) Appl. Env.
Microbiol. 59: 695-700
Appendix – Applications of DGGE
• To study gut microbial ecology
during disease
• Performed 16S rDNA DGGE on the
microbiota of mice during the
development of colitis
• Found 4 groups more prevalent in
colitis: Bacteroides sp., Bif. animalis, Cl.
cocleatum and enterococci
• Found 2 groups less prevalent: Eub.
ventriosum and lactobacilli
The University of Nottingham
Dr Tim Aldsworth
Bibiloni et al. (2005) Letts.
Appl. Microbiol. 41:45-51
Appendix – Applications of DGGE
• To study the microflora of Stilton
cheese
• Amplified the V3 and also the V4 and
V5 regions of the cheese microflora
• PCR products sequenced after DGGE
• Found Lactococcus lactis, Ent. faecalis,
Lactobacillus curvatus, Staphylococcus
equorum and Lb. plantarum
• Lac. lactis never found by culture
The University of Nottingham
Dr Tim Aldsworth
Ercolini et al. (2003) Appl. Env.
Microbiol. 69:3540-3548
School of Life Sciences Assessment Brief Academic Year 2021-22
Section 1: Key information
Module Code
7003BMS
Module Name
Industrial and Environmental Biotechnology
Semester
2
Status
Resit
Module Leader
Tim.aldsworth@coventry.ac.uk
Assessment Title
CW1
Core /Applied Core
Applied Core
Credit weighting
10
Group/Individual
Individual
assessment
Task outline
Unless advised otherwise, for this resit (referred) assessment, you
are required to make a substantive improvement to your original
submission, following the advice and guidance given in your
original feedback.
Submission
deadline/attendance date
Submission/attendance
instructions
Word or time limit
Your task, as for the original submission, is to produce a Critical
Review of an Environmental or Industrial Biotechnology Topic
The submission deadline date and time is Mon 4th April 2022 by
18:00hrs BST.
24 hour grace period applies to allow for technical issues submissions will be accepted up to 1800h on Tuesday 5th April
2022.
Your critical review should be submitted via the Turnitin link on the
7003BMS Aula site.
2000 words
You should state your word count at the end of your work.
If you exceed the word limit by more than 10% i.e. if you exceed
2200 words, then you will be penalised by deduction of 10% of
your final mark. Work that is more than 30% above the allocated
word limit (ie 2600 words or more) will only be read up to the
allocated limit.
Special instructions
By submitting this assessment you are declaring yourself fit to do
so. If you are not fit to submit at this time you may apply for
extension to the deadline or deferral to the next assessment
period (see Extension and Deferral request instructions). Please
note that if an extension to the deadline is granted, the 24 hour
grace period DOES NOT apply.
By submitting this assessment you agree to the following statement:
I confirm that this CW submission represents my own work, and I have not received any
unauthorised assistance. I understand the rules around plagiarism, collusion and
contract cheating and that it is my responsibility to act with honesty and integrity in the
assessment process. I understand that there will be no tolerance towards academic
dishonesty, and that cheating can and will lead to serious consequences.
Section 2- Detail of the Assessment task
The assessment information from the original assessment brief is repeated below. Ensure that
you access and read fully the feedback on your original submission and are clear about the
improvements that are necessary to meet the Learning Outcomes. If you are unsure, contact
the module leader for advice.
You are required to write a critical review of an aspect of industrial and environmental
biotechnology that has been covered during this semester. Your critical review topic will be the
same as the one you were originally allocated from the list advertised as the beginning of the
first semester.
Detail of submission/ attendance instructions
A DRAFT Turnitin link is available in the Course Community Aula site to allow you to check your
similarity score prior to making your final submission. You may submit multiple times to this link,
but do remember that obtaining a similarity report may take up to 24 hours.
The FINAL Turnitin link on the module Aula page (labelled as 7003BMS CW1 Critical Review
resit FINAL submissions) is for submission of your work for assessment. You may submit only
ONCE to this link. Remember that submission make take some time to complete, so aim to
submit several hours before the deadline. The TurnitinUK system will record the date and time
of your submission and cannot be over-written.
Please convert your final submission to a PDF format as these suffer less from formatting
changes.
If you experience any technical problems when trying to submit your work, please consult Aula
help via the question mark link. If these problems are experienced at the time of the
submission deadline and cannot be quickly resolved, please capture screenshots as evidence
and email these and your completed assessment to the module leader asap.
Word count details
The following are included in your word allowance:
•
The text of your written work
•
Reference citations and reference to figures and tables within the text
•
Descriptive paragraphs as Figure or Table legends
•
Narrative text included in Tables
The following are excluded from your word allowance:
•
The title
•
Your student ID number, course, module name/code etc.
•
Figure and Table headings
•
Words, sequences and numbers associated with figures and tables (however extensive
narrative text presented in Tables will count)
•
Reference list
•
The word count details
Section 3: Help and Support
•
The skills learned from writing the critical review for 7025BMS should be applied to writing
this critical review.
•
Please read carefully the feedback and advice that is given to you on the critical review
feedback in TurnItIn, and use this as the basis for the improvements tat you make to your critical
review.
•
You are encouraged to book an appointment with the ML to review you initial submission
so that you are clear about the improvements required.
If you have a special requirement such as a variation of assessment need please contact the
disabilities team.
Links to additional
assessment information
Section 4: Learning Outcomes and Marking Rubric
Mapping to module
This assessment is designed to assess Learning Outcomes 1 of
Learning outcomes
the module:
Mapping to course
Learning Outcomes
Task type/scheduling
rationale
1.
Critically review a current topic in environmental or
industrial biotechnology.
This assessment relates to the following Course Learning
Outcomes:
1.
Demonstrate an understanding of a number of aspects of
biotechnology and apply knowledge to problem based scenarios.
2.
Critically analyse and synthesise scientific information in
the subject area of biotechnology and articulate and present this
effectively, through written, oral and digital formats, to a diverse
and global audience.
4.
Work effectively within a team and demonstrate creativity
and leadership skills.
The purpose of the MSc Biotechnology is to develop well-rounded
and confident professional scientists capable of communicating
with differing audiences using appropriate media. Consequently,
the aim of this assignment is for the students to write an extensive
and in-depth analysis of a given topic using a good selection of the
available literature to support those arguments.
Indicative marking criteria:
Distinction
(72-100)
Introduction
(15%)
Provide a
breakdown of
the topic set in
the question
Evidence (30%)
Finding and using up-to
date information from a
number of sources to
evaluate the question
set
Coherence
(30%)
Clarity and
structure
Conclusions
and related
outcomes
(15%)
The topic
question is
introduced in a
concise and
accurate
fashion. The
problem posed
by the
question is
considered
critically and it
is stated
clearly how
Information is taken
from a wide array of
source(s) with
evaluation to develop a
comprehensive analysis.
Student uses peer
reviewed primary
literature and has
formulated an argument
based on a critical
questioning and analysis
of the evidence
presented by the
The
structure
and
cohesion is
excellent,
clearly
evidencing a
high level of
planning.
Excellent
paragraph
formulation
and order,
Conclusions
and related
outcomes are
logical and
reflect
student’s
informed
evaluation
and ability to
place
evidence and
perspectives
Presentation
and
Referencing
(10%)
Standard of
writing,
formatting
according to
coursework
brief, and
referencing.
The work is
well
formatted
and the
writing is of a
high
standard.
Citations and
references
are entirely
formatted to
APA
Referencing
the review will
evaluate it.
The
introduction
delivers all
relevant
information
necessary to
demonstrate
full
understanding.
The topic
question is
introduced in a
succinct
fashion with
very few
omissions.
The
introduction
describes and
clarifies most
of the relevant
information so
that
understanding
is not seriously
impeded by
omissions.
authors. At the higher
end, the analysis and
evidence would be of a
publishable quality.
so that
research is
highly
synthesised
and lines of
argument
are
exceptionally
clear
throughout.
discussed in
priority order.
Style. At the
higher end,
the work
would be of
publishable
standard.
Information is taken
from source(s) with
evaluation to develop a
coherent analysis or
synthesis. Student uses
peer reviewed primary
literature and has
formulated an argument
based on a reasonably
critical questioning and
discussion of the
evidence presented by
the authors.
Conclusion is
logically-tied
to a range of
information,
including
opposing
viewpoints;
related
outcomes are
identified
clearly.
The work is
mostly well
formatted,
with
appropriate
headings and
structure.
Writing is of a
high
standard.
Citations and
references
are mostly
formatted to
APA
Referencing
Style.
Good
Pass
(52, 55, 58)
The topic is
introduced
with some
omissions.
There is
evidence of
some critical
review of the
disease topic,
but the
introduction
leaves some
terms
undefined,
ambiguities
unexplored,
and/or
background
unknown.
Information is taken
from source(s) with
some interpretation/
evaluation, but not
enough to develop a
coherent analysis or
synthesis. Student
relies mainly on review
articles, over primary
sources. Student has
mainly taken evidence
from authors as mostly
fact, with only some
critical questioning and
discussion.
Conclusion is
logically-tied
to information
(because
information is
chosen to fit
the desired
conclusion);
some related
outcomes are
identified
clearly.
The work is
generally
formatted in
a sensible
fashion. The
writing is of a
good quality,
with some
minor
grammatical
and spelling
errors.
Citations and
references
are generally
formatted to
APA
Referencing
Style with a
few minor
errors.
Low Pass
(42, 45, 48)
The topic is
briefly
Information is taken
from source(s) with very
The
structure
and
cohesion is
very good,
evidencing a
reasonably
high level of
planning.
Very good
paragraph
formulation
and order,
so that
research is
synthesised
and lines of
argument
are very
clear
throughout.
The
structure
and
cohesion is
good,
evidencing
an above
average
level of
planning.
Good
paragraph
formulation
and order,
so that
research is
fairly
synthesised
and lines of
argument
are mostly
clear
throughout
or very clear
in most
places.
The
structure
Conclusion is
inconsistently
The work is
partly
Merit
(62, 65, 68)
Fail (or
referral)
(0-35)
introduced but
there are
several
omissions in
key facts and
details. Some
terms are left
undefined and
it is unclear
what the aim
of the critical
review is.
little
interpretation/evaluation.
Viewpoints of authors
are taken as fact,
without question. Errors
in interpreting evidence
presented by authors
and very little critical
questioning and
discussion.
and
cohesion is
fair,
evidencing
some
planning.
Fair
paragraph
formulation
and/or order,
with some
research
synthesis
and/or lines
of argument
are fairly
clear
throughout
or clear in
some
places.
tied to some
of the
information
discussed;
related
outcomes are
oversimplified.
The topic is
not properly
introduced,
with many
omissions.
The
introduction is
either too long
or too short. It
lacks detail
and clarity.
Information taken from
inappropriate non-peer
reviewed source(s) such
as websites. There is
no evaluation or
interpretation of
source(s). Viewpoints of
authors are taken as
fact, without question.
At the lower end, a
simple description of
papers and no critical
analysis.
The work is
in need of
structure
and
coherence,
with specific
need for one
of the
following: (i)
planning; (ii)
paragraph
formulation
and/or order;
(iii) research
synthesis
and
arguments.
At the lower
end, there
will be little
to no
structure or
coherence.
Conclusion is
missing or
fails to
properly
summarize
the finding of
the critical
review.
Errors are
over
simplified.
formatted
correctly but
has some
errors. The
standard of
writing is fair,
but there are
several
grammatical
and spelling
errors.
Citations and
references
may be partly
or
inconsistently
formatted to
APA
Referencing
Style, and
some
citations or
references
may be
missing.
The work is
in need of a
higher
standard of
writing and /
or formatting
is not correct.
Citations and
references
are missing
and/or need
formatting to
APA
Referencing
Style.
Section 5: Marks return and feedback
Marking and moderation
This assignment brief has been moderated by a member of
Information
academic staff outside the module team.
As this is a RESIT submission, anonymous marking is not
possible as the marker will wish to access your original
submission and feedback advice. Please ensure that you add
your name to your script. Marking will be completed by academic
staff, which may include hourly paid staff. The marking will then be
moderated by a member of the module team and reviewed by an
academic staff member outside the team. The module feedback
and marks will then be moderated by the external examiner.
Feedback and return of
marks
Your mark will be reported as a banded mark according to the
School’s banded marking guidelines.
All banded marks released are subject to final Progression and
Awards Board decisions and are therefore provisional until after the
Board sits.
Provisional marks will be released on 21st April 2022 via the Aula
site in the Student Success App.
Feedback comments can be accessed by clicking on your
submission in Turnitin and selecting the comments icon. The
completed marks rubric can be accessed through the rubric icon.
If you have any questions about your feedback, contact the module
leader.
Following the Progression and Awards Board, your marks will be
confirmed, and you will be able to view your final grades through
SOLAR together with information on any resit or deferral
arrangements. If you require further clarification, contact your
Course Director or Faculty Registry.
Section 6: General Information
Penalties for late/nonWork that is submitted late, without an extension or deferral
submissions
having been granted, will receive a mark of ZERO (students will
normally be eligible for a resit attempt).
Extension and Deferral
requests
Reference formatting
SLS banded marking
scheme
Work that is not submitted or tests/exams etc not attended,
without an extension or deferral having been granted, will be
recorded as Absent (ABS). In these cases it is at the discretion of
the Progression and Awards Board as to whether you will be
permitted a resit attempt.
If you are unable to submit coursework or attend an assessment
e.g. test, examination, presentation or assessed laboratory
session, you may be eligible to apply for an extension or a
deferral. Please refer to the Extenuating Circumstances guidance
on the Student Portal.
Deferral or Extension requests must be made before the due date
of the assignment and must be accompanied by appropriate
evidence. Please be aware that deferral of an assessment
may affect your ability to progress into the next academic
year of study, therefore you are advised to seek advice from
your tutor or course director if you are considering deferring
an assessment.
Coventry University now uses the APA Referencing Style.
However, if you started your course before 1st September 2020,
you may continue to use the Coventry University Guide to
Referencing in Harvard Style until you graduate. For support and
advice on how to reference appropriately please see the online
referencing guidance or contact your Academic Liaison Librarian.
The SLS banded marking approach recognises that marking
cannot be exact and avoids students being awarded marks that lie
close to a grade boundary.
The banded marks that may be awarded are as follows:
Outstanding
82, 85, 88, 90, 95, 100
Excellent
72, 75, 78
Very Good:
62, 65, 68
Good
52, 55, 58
Academic Integrity
Acceptable
42, 45, 48
Fail (does not meet LOs)
0, 10, 20, 30, 35
Academic dishonesty hurts everyone in the community. It not only
damages your personal reputation, but also the reputation of the
entire University and it will not be tolerated at Coventry University.
It is in the best interest of all students for the University to maintain
the good reputation of its awards. Your co-operation is expected in
actively protecting the integrity of the assessment process. It is your
duty to observe high personal standards of academic honesty in
your studies and to report any instances of malpractice you become
aware of, without fail.
We expect students to act with academic integrity, which means that
they will study and produce work in an open, honest and responsible
manner. It is important, therefore, that you understand fully how to
avoid academic misconduct and where to obtain support. Academic
dishonesty covers any attempt by a student to gain unfair advantage
(e.g. extra marks) for her/himself, or for another student, in ways that
are not allowed.
Examples of such dishonesty include:
 Collusion includes the knowing collaboration, without
approval, between two or more students, or between a
student(s) and another person, in the preparation and
production of work which is then submitted as individual work.
In cases where one (or more) student has copied from another,
both (all) students involved may be penalised.
 Falsification includes the presentation of false or
deliberately misleading data in, for example, laboratory work,
surveys or projects. It also includes citing references that do not
exist.
 Deceit includes the misrepresentation or non-disclosure of
relevant information, including the failure to reveal when work
being submitted for assessment has been or will be used for
other academic purposes.
 Plagiarism is the act of using other people’s words, images
etc. (whether published or unpublished) as if they were your
own. In order to make clear to readers the difference between
your words, images etc. and the work of others, you must
reference your work correctly.
 Self-Plagiarism is the reuse of significant, identical, or nearly
identical portions of your own work without acknowledging that
you are doing so or without citing the original work, and without
the written authorisation of the module leader.
 Re-presentation is the submission of work presented
previously or simultaneously for assessment at this or any other
institution, unless authorised in writing by the module leader and
referenced appropriately.
 Exam Misconduct is any attempt to gain an unfair advantage
in an assessment (including exams/tests) or assisting another
student to do so. It includes: taking unauthorised materials into
exams,
copying
from
other
candidates,
collusion,
impersonation, plagiarism, and unauthorised access to unseen
exam papers. For online tests or exams where a time window
applies, this also includes sharing or accessing shared
questions and/or answers. In the event of an allegation of exam
misconduct you are advised to contact the Student Union
Advice Centre immediately after the incident.
For more details (including misconduct investigations and penalties)
please consult the Faculty of Health and Life Sciences Student
Handbook
Appeals and complaints
Procedures
Also consult the Academic Integrity links on the Student Portal.
If you have any concerns about your assessment results then
please contact your module leader or course director in the first
instance.
If they are unable to resolve your concerns then please contact
the Associate Head Student Experience (Jennifer Barnes-Hill
ad5089@coventry.ac.uk) or Associate Head Quality and
Accreditation (Lisa Winnall ac4711@coventry.ac.uk).
Details of the processes and criteria for formal appeals and
complaints can be accessed from the Registry Appeals and
Complaints page
7003BMS Industrial and Environmental Biotechnology
Laboratory 1: PCR amplification of 16S rRNA gene from the
environmental DNA
Methanogenic Archaea produce approximately one billion tons of methane annually,
but their biology remains largely unknown. This is partially due to the large
phylogenetic and phenotypic diversity of this group of organisms, which inhabit
various anoxic environments including peatlands, freshwater sediments, landfills,
anaerobic digesters and the intestinal tracts of ruminants.
Methanogens are difficult to isolate or culture under laboratory conditions, so
communities are often examined through culture-independent techniques. The 16S
rRNA is the central structural component of the archaeal 30S ribosomal subunit and
is required for the initiation of protein synthesis and the stabilization of correct codonanticodon pairing in the A site of the ribosome during mRNA translation. Due to the
functional constancy and highly conserved nature of the 16S rRNA gene, it has been
an important phylogenetic marker for Archaea.
During this practical, you are going to use the gDNA extracted during the
7001BMS laboratory entitled “Isolation of genomic DNA from the mixed
microbial population in the anaerobic digestate” along with the in-silico
designed primers that incorporate SacI and BamHI restriction enzyme
recognition sites (underlined in Table 1) to facilitate the restriction cloning of
the PCR amplicon into the pDL05 shuttle vector (map shown in figure 2). Use
one of the primer pairs to target:
Table 1. Sequence of the forward and reverse primers targeting the 16S rRNA
gene (Wright et al.).
Primer pairs
Primer sequence
Met1-SacI-Forward
GAGCTCGGTGCCAGCCGCCGC
Met1-BamHI-Reverse
GGATCCGCGGCGGCTGGCACC
Met2-SacI-Forward
GAGCTCGTCAGGCAACGAGCGAGACC
Met2-BamHI-Reverse
GGATCCGGTCTCGCTCGTTGCC
Met3-SacI-Forward
5’ GAGCTCGCTCAGTAACACGTGG 3’
Met3-BamHI-Reverse
5’ GGATCCCGGTGTGTGCAAGGAG 3’
Figure 2. Plasmid map of pDL05 shuttle vector with the single cutting
restriction endonucleases.
Processing of the precipitated DNA for PCR amplification
Questions:

What is DNA precipitation?
Protocol
1. Spin the precipitated DNA (kept from the 7001BMS practicals that you
undertook in semester 1) at full speed in a standard microcentrifuge for 30
minutes. (Make sure to mark the outermost edge of the tube so you can find
the pellet easily (or just put the hinge portion of the tube to the outside). It is
translucent and usually looks like a little smudge on the tube.
2. Decant (or carefully pipette off) the supernatant.
3. Air dry the pellet. (keep tubes open, ~15 min) NB overdrying can make DNA
hard to re-dissolve.
4. Re-suspend the DNA pellet in 50 µL DNAse/RNase free water.
Use the Nanodrop spectrophotometer to check your DNA concentration and quality.
Measuring of the concentration of gDNA
Protocol
1. Place 2 µL of sterile water onto the Nanodrop and blank the instrument, wipe
the liquid after the measurement an proceed to step 2
2. Place 2 µl of your gDNA sample onto the Nanodrop platform and run an
absorption spectrum from 320nm to 230nm. Print your spectrum and attach it
into your results section. Keep the remainder of your sample for the PCR.
4
Amplification the 16S rRNA gene from purified and concentrated DNA:
Pipette carefully and accurately the following reagents into one 0.5 mL Eppendorf
tube (label the tube with your initials):
Reagent
Template DNA (100 ng)
PCR Mastermix 2x
Primer Forward 10 µM
Primer Reverse 10 µM
Water
Volume/ µL
Add an appropriate volume to give 100
ng
10 µL
1 µL
1 µL
Make up to a total volume of 20 µL
1. Mix all reagents by pipetting the liquid up and down using the micropipette and
centrifuge the tube briefly to move all the liquid to the bottom of the tube
2. Place your tube into the thermocycler. Using the following settings:
Initial denaturation for 3 min at 95˚C and 35 cycles of:
40 s at 95˚C
30 s at 63˚C
30 s at 72˚C
and the final extension for 7 min at 72˚C
Your samples will be stored at 4˚C until the next laboratory session.
5
Laboratory 2: Restriction cloning of PCR amplicon into PDL05
shuttle vector
Gel electrophoresis
Run your PCR amplicons on the agarose gel according to the following instructions:
Preparation of the agarose gel
1. You will be provided with 35 ml of molten 1.5% agarose to which the dye Gel Red
has been added. This dye is a safer alternative to ethidium bromide for DNA staining.
The dye stains the DNA by intercalation between the base pairs and allows the
bands to be visualised under UV light. Pour the molten agarose into the gel
apparatus (make sure end plates and comb are firmly in place). Leave to set on the
bench.
2. When the agarose is set, pour 50 ml gel running buffer (TBE) onto the top of the gel.
Remove the end plates and comb and stand the gel on a sheet of black paper. Do
not move the gel once you have started loading your samples.
Preparation of the samples and loading the gel
1. Add 5 μl bromophenol blue loading dye to your PCR tube and mix gently
2. Briefly centrifuge the PCR tubes to ensure the blue liquid is at the bottom
3. Using a P200 pipette collect 25μl of sample. Load the 25μl sample into the required
well of the gel. Use the central 6 wells for the samples. Keep a record of which
sample went into which well.
4. Load 20l DNA markers into the two outer wells of the gel. The markers are a
mixture of DNA fragments of known size which will allow you to determine the size of
your PCR products.
5. Connect the gel to the power pack and run for about 60 min at 100mA per gel.
6
Visualisation of DNA bands
1. At the end of the electrophoresis run, turn off the power pack.
2. Tip the running buffer into the waste container.
3. Place the gel (removed from the tank) into the transiluminator. Visualize the bands
and cut out the desired product using the sharp scalpel.
4. Place the gel slice in a 1.5 mL Eppendorf tube and store in the fridge for use in the
next step.
DNA isolation from the agarose gel
1. Weigh an empty Eppendorf tube and then weigh the Eppendorf tube with your
agarose gel slice
2. Record the mass of your gel slice
Isolation of DNA from agarose gel
1. Add 3 volumes of Buffer QG to 1 volume of gel, for example add 300 μl of Buffer
QG to each 100 mg of gel
2. Incubate at 50°C for 10 min (or until the gel slice has completely dissolved). To
help dissolve gel, mix by vortexing the tube every 2-3 min during the incubation
3. After the gel slice has dissolved completely, check that the color of the mixture is
yellow (similar to Buffer QG without dissolved agarose)
4. Add 1 gel volume of isopropanol to the sample and mix
5. Place a QIAquick spin column in a provided 2 ml collection tube.
6. To bind DNA, apply the sample to the QIAquick column, and centrifuge for 1 min
7. Discard flow-through and place QIAquick column back in the same collection
tube
8. Wash the column with 0.5 ml of Buffer QG and centrifuge for 1 min, discard the
flow through
9. Wash the column with 0.75 ml of Buffer PE and centrifuge for 1 min
10. Discard the flow-through and centrifuge the “empty” QIAquick column for an
additional 1 min to remove any remaining PE buffer
7
11. Place QIAquick column into a clean 1.5 ml microcentrifuge tube
12. To elute DNA, add 20 μl of warm, sterile water to QIAquick membrane and
centrifuge, let the column stand for 1 min, and then centrifuge for 1 min.
Restriction digest of pDL05 vector with SacI and BamHI restriction enzymes
Pipette carefully and accurately the following reagents into one 0.5 mL Eppendorf
tube (label the tube with your initials):
Reagent
Plasmid DNA – pDL05
CutSmart Buffer 10x
SacI enzyme
BamHI enzyme
Water
Volume/ µL
3.5 µL
2 µL
1 µL
1 µL
12.5 µL -> total reaction volume 20 µL
Incubate at 37°C in the hotplate for 30 min, then deactivate the enzyme at 65°C for
10 min.
Digestion of the purified PCR product with SacI and BamHI enzymes
Pipette carefully and accurately the following reagents into one 0.5 mL Eppendorf
tube (label the tube with your initials):
Reagent
Purified amplicon
CutSMart Buffer 10x
SacI enzyme
SamHI enzyme
Water
Volume/ µL
10 µL
2 µL
1 µL
1 µL
6 µL -> total reaction volume 20 µL
Incubate at 37°C in the hotplate for 30 min, then deactivate the enzyme at 65 °C for
10 min.
Ligation of the PCR amplicon and the digested vector
Ligation involves the formation of phosphodiester bonds between adjacent 5’phosphate and 3′-hydroxyl residues; it is catalyzed by bacteriophage T4 DNA ligase.
8
Pipette carefully and accurately the following reagents into one 0.5 mL Eppendorf
tube (label the tube with your initials):
Reagent
Digested plasmid DNA – pDL05
Purified PCR amplicon
Ligation Buffer
T4 ligase
Water
Volume/ µL
1 µL
4 µL
1 µL
1 µL
3 µL
The reaction will be incubated at room temperature until the next laboratory session.
9
Laboratory 3: Transformation of the ligation mixture in lambda pir
E. coli competent cells
Materials needed:
–
Lambda pir E. coli competent cells
LB agar plates containing Ampicillin (100 μg/ml)
1. Place the ligation mixture on ice.
2. Thaw on ice, two 50 μL vials of the competent cells for each ligation.
3. Pipette 5 μL of ligation reaction directly into the vial of competent cells and
mix by tapping gently. Do not mix by pipetting up and down. Label the
tube with your initials.
4. Incubate the competent cells and the ligation mixture on ice for 15 min
5. Heat shock the vial with cells and the ligation mixture in the water bath set
to 42°C for 45 s and then move the tube on ice and keep it on ice for 1 min
6. Spread your transformed cells on two pre-warmed, labelled LB agar plates
(each containing 100 μg/mL ampicillin)
7. Incubate the plates at 37°C overnight.
Record the results
10
Laboratory 4 Screening for recombinant clones by colony PCR and
agarose gel electrophoresis
Colony PCR is a method used to screen for plasmids containing a desired insert
directly from bacterial colonies without the need for culturing or plasmid purification
steps
Protocol
1. Pick a colony from the transformation plate
2. Perform the PCR using suspended E. coli cells as the template
Pipette carefully and accurately the following reagents into one 0.5 mL Eppendorf
tube (label the tube with your initials):
Reagent
Template
PCR Mastermix 2x
Primer Forward 10 µM
Primer Reverse 10 µM
Water
Volume/ µL
Pick a colony and suspend in PCR mix
10 µL
1 µL
1 µL
8 µL
3. Mix all reagents by pipetting the liquid up and down using the micropipette and
centrifuge the tube briefly to move all the liquid to the bottom of the tube
4. Place your tube into the thermocycler. Using the following settings:
Initial denaturation for 3 min at 95˚C and 35 cycles of:
40 s at 95˚C
30 s at 63˚C
30 s at 72˚C
and the final extension for 7 min at 72˚C
11
(a) Gel electrophoresis
Preparation of the agarose gel
1. You will be provided with 35 ml of molten 1.5% agarose to which the dye Gel Red
has been added. This dye is a safer alternative to ethidium bromide for DNA staining.
The dye stains the DNA by intercalation between the base pairs and allows the
bands to be visualised under UV light. Pour the molten agarose into the gel
apparatus (make sure end plates and comb are firmly in place). Leave to set on the
bench.
2. When the agarose is set, pour 50 ml gel running buffer (TBE) onto the top of the gel.
Remove the end plates and comb and stand the gel on a sheet of black paper. Do
not move the gel once you have started loading your samples.
Preparation of the samples and loading the gel
3. Add 5 μl bromophenol blue loading dye to your PCR tube and mix gently
4. Briefly centrifuge the PCR tubes to ensure the blue liquid is at the bottom
5. Using a P200 pipette collect 25μl of sample. Load the 25μl sample into the required
well of the gel. Use the central 6 wells for the samples.
6. Load 20l DNA markers into the two outer wells of the gel. The markers are a
mixture of DNA fragments of known size which will allow you to determine the size of
your PCR products.
7. Connect the gel to the power pack and run for about 60 min at 100mA per gel.
Visualisation of DNA bands
5. At the end of the electrophoresis run, turn off the power pack.
6. Tip the running buffer into the waste container.
7. Place the gel (removed from the tank) into the transiluminator. Visualize the bands
and cut out the desired product using the sharp scalpel.
Record your results
12
7003BMS
A Culture-free Metagenomic Analysis of the
Microflora Diversity Present in an Anaerobic
Digestate
Introduction
In this suite of laboratory practical classes, we will be using a culture-free
metagenomic technique called Denaturing Gradient Gel Electrophoresis (DGGE) to
explore the diversity of bacterial species that can be found in a sample of digestate
from an anaerobic digester. The use of DGGE allows us to explore a diversity of
species more rapidly than traditional plate counting and biochemical analysis.
Traditional microbiological techniques that involve the culture of bacteria in laboratory
media are relatively simple to undertake, but have a number of drawbacks. Firstly,
not all bacteria that can be found in the environment are currently amenable to
culture in the laboratory. In fact, it is believed that we are able to culture in the
laboratory less than 10% of all bacterial species that actually exist on planet earth.
Secondly, traditional plate culture and subsequent biochemical identification methods
are relatively slow. Even for a fast-growing bacterial species such as E. coli it can
take at least 24 hours of incubation before you have sufficient growth on an agar plate
or in a broth medium. After that, to determine the identity of the isolate, you have to
perform further biochemical tests that can also take at least 6, and up to 48, hours.
Slower-growing species such as Mycobacterium tuberculosis can take up to 6 weeks,
even before undertaking any biochemical identification tests! As a consequence,
faster molecular methods that are capable of demonstrating the presence of many
different species without any need to culture them first, are at a premium.
For these labs we will be using the DGGE technique – first published by Muyzer et al.
(1993) – which relies on the use of a chemical denaturant gradient to separate
samples of bacterial DNA on the basis of sequence. As you are aware, the duplex
DNA strand is made of pairs of complementary bases – either A and T, or G and C –
which have a different number of hydrogen bonds – 2 between A and T, and 3
between G and C. This means that when a fragment of double-stranded DNA is
exposed to elevated temperatures, or to sufficiently high concentrations of particular
denaturant chemicals, the DNA strand will “melt” and separate into 2 single strands.
However, the precise temperature (or denaturant concentration) at which it melts is
directly related to the AT:GC ratio in the DNA fragment; more AT means a lower
melting “temperature” and more GC means a higher melting “temperature”.
Consequently, the DGGE gel comprises a bis-acrylamide matrix into which a gradient
of denaturant chemicals has been cast. In this case the chemical denaturants used
are Urea and Formamide. Two stock denaturant solutions are prepared, one called
“0%” and one called “100%”. The “0%” denaturant solution is composed solely of
bis-acrylamide in water, with 1 X TAE buffer included to provide buffering capacity.
The “100%” denaturant solution is composed of bis-acrylamide, water, 1 X TAE, and
also 7M Urea and 40% Formamide. The concentration of bis-acrylamide used in the
stock denaturant solutions can be varied depending upon the size of the DNA
fragments being examined. For the purposes of these practicals, we will be using 8%
bis-acrylamide in the denaturants.
Having prepared stocks of the “0%” and “100%” denaturants, these can be combined
in any ratio desired to give a gradient from “Low” (at the top of the gel) to “High” (at
the bottom of the gel) denaturant concentrations. To achieve this, the “0%” and
“100%” denaturant stocks are mixed in variable ratios to produce the “Low” and
“High” concentration denaturant solutions for a specific gel. For example if you
wanted to make a 50% denaturant solution, you would mix equal parts of the “0%”
and the “100%” stocks. Each gel is cast into a cassette of 2 glass plates sandwiched
together, and the bis-acrylamide is polymerised to yield polyacrylamide.
DNA
samples are loaded into the wells that have been cast into the polyacrylamide gel, and
then exposed to an electrical current as with any other electrophoresis (NB there is a
little more complexity than this involved, but it will be explained further in the
practical schedule for the second lab class).
You may have experienced agarose gel electrophoresis of DNA samples in past
laboratory classes. You may also be familiar with the concept that agarose gel
electrophoresis separates DNA fragments on the basis of “size” (or molecular weight)
so that larger DNA fragments run more slowly than smaller fragments and so these
eventually separate out into individual bands as the electrophoresis proceeds.
However, DGGE does not separate the DNA fragments on the basis of “size”, but
rather of sequence. This is because the denaturant gradient that has been cast into
the gel causes DNA fragments of different sequence to melt at different positions
through the gel. For example, if you imagine a fragment of DNA composed solely of A
and T bases, this would melt at a much lower denaturant chemical concentration than
one composed solely of Gs and Cs. Consequently, the A-T fragment would melt
higher up the gel (where the denaturant concentration is high enough to melt it, but
not the G-C fragment) whilst the G-C fragment would not melt until it reached the
bottom of the gel (where the denaturant concentration is sufficiently high). Thus the
two fragments would be resolved into 2 distinct and separate bands in the gel. It has
been claimed that this technique is sufficiently sensitive that you can resolve
fragments with only a single base-pair difference into separate bands.
DGGE can be used to separate any fragments of DNA that you may wish. However,
since we are seeking to determine the diversity of species present in a sample of
unknown bacteria taken from an anaerobic digester, we need a gene that can be
found in all bacterial species. One such gene is the 16S ribosomal RNA gene. To the
best of our knowledge, the 16S rRNA is found in all bacterial species (but not in
Eukaryotes). The structure of the 16S rRNA is such that there are some non-variable
conserved regions in it – these are the functional parts of the ribosome and any
changes to these are likely to impair ribosomal function and thus lead to bacterial cell
death (ie they do not pass from generation to generation). On the other hand, there
are other regions of the 16S rRNA that are variable in sequence – these can be
conceived of as stretches of RNA that link the conserved regions together. There
appear to be about 8 or 9 variable (or V) regions within a 16S rRNA gene. The
variable regions are subject to mutation, just as with all DNA, but mutations to them
are not lethal to the bacterial cell and so these mutations can accumulate over time.
This means that even closely-related bacterial species (eg E. coli and Shigella
dysenteriae) will have unique sequences to their V regions. In fact, this is the
principle that is used to help identify an unknown bacterial isolate – sequence the 16S
rRNA gene and then compare this sequence with a database of known species to find
a match. Since the sequence of each V region is unique to a given species it can be
as effective as a fingerprint in determining identity.
To produce the DNA sample to separate on a DGGE gel, you first need to extract the
bacterial DNA from your sample.
This can be done using phenol-chloroform
extraction, although for ease extraction kits are often used, eg the Qiagen PowerSoil
bacterial DNA extraction kit could be used to extract DNA from a soil sample. Next
the appropriate V region from the extracted DNA needs to be amplified by PCR. To
perform PCR amplification you need primers, and since the non-variable conserved
regions are very similar across all species of bacteria it is possible to design a single
pair of primers that should be effective for all species of bacteria. For example, if you
want to amplify the V3 region, you would design a primer pair that anneals to the
conserved regions that immediately flank the V3 region and these primers would
“read through” that region and allow it to be amplified. Similarly, with a different pair
of primers, you could amplify the V4 region, and so on.
Once you have produced your PCR amplification products, it is normal to perform an
agarose gel electrophoresis as a quality-control step to ensure that you have PCR
products of the appropriate molecular weight. For example, the V3 region yields a
product of around 200 bp. This means that you should get a single band equating to
approximately 200 bp on an agarose gel, regardless of how many bacterial species
were in the original sample (ie whether there were 2 or 2000 species, you would only
get 1 band). Once you have confirmed that you have a PCR product of the
appropriate molecular weight, then you load the sample onto the DGGE gel, perform
the electrophoresis, and separate the different V3 region fragments on the basis of
differences in their sequence not their molecular weight.
For the first laboratory practical class, we will prepare PCR reaction mixtures and
perform the PCR amplification. For the second laboratory practical class we will load
our PCR products onto agarose gels for our “quality control” electrophoresis. Due to
constraints on time, we will also load the PCR products onto the DGGE gels and
separate them by electrophoresis concurrently, but this is not normal practice as it is
wasteful of time and materials if your extraction and PCR amplification were
unsuccessful. We will then examine both our agarose and our DGGE gels in a
subsequent lab and workshop.
Lab 1 – PCR amplification of V3 regions of 16s rRNA
from environmental DNA samples
Protocol
You will be supplied with samples of DNA that have already been extracted from the
digestate from an anaerobic reactor (you will be using more of the same DNA samples
as in the mcrA analysis labs). All of the following is to be done individually.
1. Label 2 of the 200 µl PCR tubes with your initials, and then label one as “C”
(control) and one as “S” (sample).
2. Add 44 µl of PCR Mastermix to both PCR tubes (mastermix, in a total of 50 µl,
comprises: 1.25 U Taq polymerase; 0.2 mM each deoxyribonucleotide
3.
4.
5.
6.
7.
8.
9.
triphosphates; 1XThermoPol® Reaction Buffer).
Add 2 µl of the GC-clamped V3 forward primer (see Table 1 for the sequence) to
both of your PCR tubes.
Add 2 µl of the V3 reverse primer (see Table 1 for the sequence) to both of your
PCR tubes.
Add 2 µl of the DNA template to the PCR tube marked “S”.
Add 2 µl of sterile RO water to the PCR tube marked “C”.
Mix the contents of both tubes by flicking them gently with your fingertips.
Centrifuge both tubes briefly to settle all of the reagents to the bottom of the
tubes.
Carefully load your PCR tubes into the PCR block and run the PCR reaction using
the following conditions: Initial melting = 94oC for 5 minutes; followed by 10
cycles of melting at 94oC for 1 minute, annealing at 65oC (reducing by 1oC per
cycle to a final temperature of 55oC), and extension at 72oC for 3 minutes;
followed by 20 cycles of melting at 94oC for 1 minute, annealing at 55oC, and
extension at 72oC for 3 minutes; followed by a final extension step of 72oC for 10
minutes (see Table 2 for a summary of the programme)
Table 1 – PCR primer sequences
GC-clamped V3-forward (338f)
V3-reverse (518r)
5′- CGC CCG CCG CGC GCG GCG GGC GGG
GCG GGG GCA CGG GGG G – ACT CCT ACG
GGA GGC AGC AGCAG-3′
5′-ATT ACC GCG GCT GCT GG-3′
Table 2 – (touchdown) PCR programme
Step
Temperature (°C)
Initial melting
94
Melting
94
Annealing (10 cycles)
65-55 (reducing by 1oC per cycle)
(20 cycles)
55
Extension
72
Final extension
72
Time (min)
5
1
1
1
3
10
Lab 2 – Casting the DGGE gel
This will be done as a demonstration.
Warning – acrylamide monomer is a toxin, a neurotoxin, and a potential
carcinogen, whilst formamide is toxic and potentially teratogenic. TEMED is
also toxic and has a very unpleasant odour. APS is a strong oxidising agent
that can cause fires or the release of toxic fumes when mixed with other
chemicals. Always use the smallest amount necessary, wear double gloves
whilst handling these (as well as your lab-standard lab coat and safety
glasses), and use them in a fumehood.
Protocol
In simple terms, a supply of gel cassettes will be constructed first, after cleaning all of
the equipment with 70% IMS. A gel cassette consists of 2 x glass plates (1 inner –
shorter – and 1 outer – taller), 2 x plastic spacers (1 mm in our case) and 2 x clamps.
The glass plates must be checked for chips and cracks before use as these can lead to
leaks or, worse still, they can shatter and expose you to glass shards covered in
acrylamide monomer.
These gel cassettes will then be loaded in pairs into the casting trays. Again the
casting trays are cleaned with 70% IMS before use, and the foam rubber gaskets
checked for tears or other damage that could allow leakage.
For each gel, 2 beakers will be labelled – one H and one L as noted above – and
appropriate volumes of 0 and 100% denaturant added to each beaker to yield the
desired H and L denaturant concentrations to a total volume of 15 ml (the 16 cm gel
plates with 1 mm spacers we’re using require 30 ml of denaturant). To the H beaker
will then be added 13.5 µl of blue gel dye. Next to both beakers will be added 13.5 µl
of TEMED and 100 µl 10% APS to initiate polymerisation – once this is done you must
work briskly as acrylamide will polymerise (set) quickly. Both beakers are mixed
briefly and gently (avoid aeration as oxygen inhibits polymerisation) and the contents
of each aspirated into a separate syringe (one labelled H and one labelled L).
Finally, the syringes are loaded into a dispenser-and-gradient-former apparatus,
attached to tubing ending in a blunt needle (handle with care – danger of needlestick
injuries), and the contents dispensed into a gel cassette to yield a denaturant
gradient. Finally, the acrylamide is allowed to polymerise ready for use – this can
take several hours at room temperature, or it can be allowed to proceed overnight at
4oC (this is what we will be doing).
Lab 3 – Loading and running the agarose and DGGE
gels
Loading and running the DGGE gels
Before the start of this lab, the DGGE tank will have been filled with 7 l of 1 x TAE
buffer and pre-warmed to 65oC. At the same time, the pre-prepared gels will be
taken from the fridge and allowed to warm to room temperature.
The following will be done as a demonstration. The gels will be loaded into the gelcarrier – you must use 2 gels per tank (or make a “dummy” gel to use alongside a
single one if you only plan to run one gel) – and this will be loaded into the gel tank.
The gel tank pump and heater will be run for a short while to bring the temperature
back to 65oC and to fill the header tank with pre-warmed buffer. Finally, the system
will be turned off, the lid removed and 1 well in each gel loaded with 5 µl of loading
dye so that you can see where the wells are.
Protocol
Each student will mix 5 µl of loading dye with separate 15 µl volumes of both their
amplified extract and their control sample in PCR tubes. Give these a brief spin in a
microfuge to bring all of the liquid to the bottom of the tube. You will then load the
entire contents of each tube into a separate well on the DGGE gel – make a note of
which wells you put your samples in!
Return the lid to the DGGE tank and switch the heater and the pump back on. Adjust
the temperature down to 60oC to actually run the gel. Attach a powerpack to the gel
lid and set the voltage to 20 V for 15 minutes to pack the DNA into the gel. After this
adjust the voltage to 140 V if you want to run the gel quickly (around 4 h) or around
30-40 V if you want to run it more slowly (overnight).
Preparing the Agarose Gels
You will be supplied with 30 ml of molten agarose in 1 x TBE buffer, tempered to 50oC
in a waterbath.
1) Assemble the agarose gel casting and running tank by inserting a solid blanking
card into the slots at each end of the tank (total 2) and by inserting a well-forming
comb (usually 8 well, but may be more or less) into the groove at the negative (black
terminal) end of the tank close to a blanking card.
2) Collect a flask containing molten agarose from the 50oC waterbath (do not take
a flask sooner than you need it, as it will cool and set very quickly) and pour it briskly
into the chamber between the blanking plates in the casting tank. You need to do this
quickly enough to prevent the agarose from setting in the flask or forming lumps and
flow lines in the tank, but not so quickly as to get lots of foaming and air bubbles in
the gel once cast. If you do get airbubbles, take a sterile yellow pipette tip and prick
the bubbles with it to burst them; this must be done before the gel has set.
3) Once the gel has set, remove the blanking plates from the tank (but not the
comb) and pour around 50 ml of 1 x TBE into the tank so that the gel is completely
submerged.
4) Remove the comb gently so as not to damage the gel, and make sure that each
well has filled with buffer.
Loading, running and viewing the agarose gels
1) Mix 9 µl of your PCR products (you should have 2 samples – your amplified DNA
(S) and a water control (C) from Lab 1) with 3 µl of loading dye and very gently load
the sample into the well.
To load a DNA sample into an agarose gel well, you need to hold the loaded
pipette such that the pipette tip is inserted into the buffer and is just above the
intended well, but not actually in it (so as not to damage it). You then need to expel
the sample very gently and slowly from the pipette. Do not attempt to pump the
sample into the well as the pressure will just blast it back out of the well; you need to
let the density of the sample + loading dye drag the sample into the well.
2) Place the lid back on the tank, attach the leads to the powerpack (ensuring the
correct polarity in both cases) and then set the gel to run at 70 V initially. If the blue
loading dye front hasn’t moved far enough, or at all, after 20 minutes, then you could
try increasing the voltage to 120 V, but do be careful not to melt the gel!
3) Once the blue loading dye front has reached at least half way down the gel, but
has not reached the end, switch the powerpack off at both the powerpack and the
mains switch before removing the lid from the tank.
4) Pour the spent buffer carefully into one of the chemicals sinks, taking care not to
splash yourself, and rinse it away with copious tap water.
5) Using the cookery spatula provided, gently list the gel out of the tank and onto
one of the GelDoc trays (purple handle for UV transillumination).
6) Insert the GelDoc tray + gel into a GelDoc and view under UV light using the
GelRed programme. If the gel is off centre, move it by gently pushing it with the
spatula; you could also pipette a little distilled water under the gel to ease moving it
around.
7) Once you are satisfied with your image, download it as a JPEG for insertion into
your assessed poster, and carefully dispose of the gel in the designated gel waste
container.
8) Finally, rinse and dry the GelDoc tray and return it to the storage area.
Lab 4 – Staining and Viewing of DGGE Gels
Removing the gels from the cassettes
This will be done by the lab leader.
Staining the gels
Each gel will be stained for 30 minutes using 50 ml 1x TAE to which 5 µl of GelRed
nuclear stain has been added.
Viewing the gels
We will view the gels under UV light using the BioRad ChemiDoc system.
7003BMS Industrial and Environmental Biotechnology
Laboratory 1: PCR amplification of 16S rRNA gene from the
environmental DNA
Methanogenic Archaea produce approximately one billion tons of methane annually,
but their biology remains largely unknown. This is partially due to the large
phylogenetic and phenotypic diversity of this group of organisms, which inhabit
various anoxic environments including peatlands, freshwater sediments, landfills,
anaerobic digesters and the intestinal tracts of ruminants.
Methanogens are difficult to isolate or culture under laboratory conditions, so
communities are often examined through culture-independent techniques. The 16S
rRNA is the central structural component of the archaeal 30S ribosomal subunit and
is required for the initiation of protein synthesis and the stabilization of correct codonanticodon pairing in the A site of the ribosome during mRNA translation. Due to the
functional constancy and highly conserved nature of the 16S rRNA gene, it has been
an important phylogenetic marker for Archaea.
During this practical, you are going to use the gDNA extracted during the
7001BMS laboratory entitled “Isolation of genomic DNA from the mixed
microbial population in the anaerobic digestate” along with the in-silico
designed primers that incorporate SacI and BamHI restriction enzyme
recognition sites (underlined in Table 1) to facilitate the restriction cloning of
the PCR amplicon into the pDL05 shuttle vector (map shown in figure 2). Use
one of the primer pairs to target:
Table 1. Sequence of the forward and reverse primers targeting the 16S rRNA
gene (Wright et al.).
Primer pairs
Primer sequence
Met1-SacI-Forward
GAGCTCGGTGCCAGCCGCCGC
Met1-BamHI-Reverse
GGATCCGCGGCGGCTGGCACC
Met2-SacI-Forward
GAGCTCGTCAGGCAACGAGCGAGACC
Met2-BamHI-Reverse
GGATCCGGTCTCGCTCGTTGCC
Met3-SacI-Forward
5’ GAGCTCGCTCAGTAACACGTGG 3’
Met3-BamHI-Reverse
5’ GGATCCCGGTGTGTGCAAGGAG 3’
Figure 2. Plasmid map of pDL05 shuttle vector with the single cutting
restriction endonucleases.
Processing of the precipitated DNA for PCR amplification
Questions:

What is DNA precipitation?
Protocol
1. Spin the precipitated DNA (kept from the 7001BMS practicals that you
undertook in semester 1) at full speed in a standard microcentrifuge for 30
minutes. (Make sure to mark the outermost edge of the tube so you can find
the pellet easily (or just put the hinge portion of the tube to the outside). It is
translucent and usually looks like a little smudge on the tube.
2. Decant (or carefully pipette off) the supernatant.
3. Air dry the pellet. (keep tubes open, ~15 min) NB overdrying can make DNA
hard to re-dissolve.
4. Re-suspend the DNA pellet in 50 µL DNAse/RNase free water.
Use the Nanodrop spectrophotometer to check your DNA concentration and quality.
Measuring of the concentration of gDNA
Protocol
1. Place 2 µL of sterile water onto the Nanodrop and blank the instrument, wipe
the liquid after the measurement an proceed to step 2
2. Place 2 µl of your gDNA sample onto the Nanodrop platform and run an
absorption spectrum from 320nm to 230nm. Print your spectrum and attach it
into your results section. Keep the remainder of your sample for the PCR.
4
Amplification the 16S rRNA gene from purified and concentrated DNA:
Pipette carefully and accurately the following reagents into one 0.5 mL Eppendorf
tube (label the tube with your initials):
Reagent
Template DNA (100 ng)
PCR Mastermix 2x
Primer Forward 10 µM
Primer Reverse 10 µM
Water
Volume/ µL
Add an appropriate volume to give 100
ng
10 µL
1 µL
1 µL
Make up to a total volume of 20 µL
1. Mix all reagents by pipetting the liquid up and down using the micropipette and
centrifuge the tube briefly to move all the liquid to the bottom of the tube
2. Place your tube into the thermocycler. Using the following settings:
Initial denaturation for 3 min at 95˚C and 35 cycles of:
40 s at 95˚C
30 s at 63˚C
30 s at 72˚C
and the final extension for 7 min at 72˚C
Your samples will be stored at 4˚C until the next laboratory session.
5
Laboratory 2: Restriction cloning of PCR amplicon into PDL05
shuttle vector
Gel electrophoresis
Run your PCR amplicons on the agarose gel according to the following instructions:
Preparation of the agarose gel
1. You will be provided with 35 ml of molten 1.5% agarose to which the dye Gel Red
has been added. This dye is a safer alternative to ethidium bromide for DNA staining.
The dye stains the DNA by intercalation between the base pairs and allows the
bands to be visualised under UV light. Pour the molten agarose into the gel
apparatus (make sure end plates and comb are firmly in place). Leave to set on the
bench.
2. When the agarose is set, pour 50 ml gel running buffer (TBE) onto the top of the gel.
Remove the end plates and comb and stand the gel on a sheet of black paper. Do
not move the gel once you have started loading your samples.
Preparation of the samples and loading the gel
1. Add 5 μl bromophenol blue loading dye to your PCR tube and mix gently
2. Briefly centrifuge the PCR tubes to ensure the blue liquid is at the bottom
3. Using a P200 pipette collect 25μl of sample. Load the 25μl sample into the required
well of the gel. Use the central 6 wells for the samples. Keep a record of which
sample went into which well.
4. Load 20l DNA markers into the two outer wells of the gel. The markers are a
mixture of DNA fragments of known size which will allow you to determine the size of
your PCR products.
5. Connect the gel to the power pack and run for about 60 min at 100mA per gel.
6
Visualisation of DNA bands
1. At the end of the electrophoresis run, turn off the power pack.
2. Tip the running buffer into the waste container.
3. Place the gel (removed from the tank) into the transiluminator. Visualize the bands
and cut out the desired product using the sharp scalpel.
4. Place the gel slice in a 1.5 mL Eppendorf tube and store in the fridge for use in the
next step.
DNA isolation from the agarose gel
1. Weigh an empty Eppendorf tube and then weigh the Eppendorf tube with your
agarose gel slice
2. Record the mass of your gel slice
Isolation of DNA from agarose gel
1. Add 3 volumes of Buffer QG to 1 volume of gel, for example add 300 μl of Buffer
QG to each 100 mg of gel
2. Incubate at 50°C for 10 min (or until the gel slice has completely dissolved). To
help dissolve gel, mix by vortexing the tube every 2-3 min during the incubation
3. After the gel slice has dissolved completely, check that the color of the mixture is
yellow (similar to Buffer QG without dissolved agarose)
4. Add 1 gel volume of isopropanol to the sample and mix
5. Place a QIAquick spin column in a provided 2 ml collection tube.
6. To bind DNA, apply the sample to the QIAquick column, and centrifuge for 1 min
7. Discard flow-through and place QIAquick column back in the same collection
tube
8. Wash the column with 0.5 ml of Buffer QG and centrifuge for 1 min, discard the
flow through
9. Wash the column with 0.75 ml of Buffer PE and centrifuge for 1 min
10. Discard the flow-through and centrifuge the “empty” QIAquick column for an
additional 1 min to remove any remaining PE buffer
7
11. Place QIAquick column into a clean 1.5 ml microcentrifuge tube
12. To elute DNA, add 20 μl of warm, sterile water to QIAquick membrane and
centrifuge, let the column stand for 1 min, and then centrifuge for 1 min.
Restriction digest of pDL05 vector with SacI and BamHI restriction enzymes
Pipette carefully and accurately the following reagents into one 0.5 mL Eppendorf
tube (label the tube with your initials):
Reagent
Plasmid DNA – pDL05
CutSmart Buffer 10x
SacI enzyme
BamHI enzyme
Water
Volume/ µL
3.5 µL
2 µL
1 µL
1 µL
12.5 µL -> total reaction volume 20 µL
Incubate at 37°C in the hotplate for 30 min, then deactivate the enzyme at 65°C for
10 min.
Digestion of the purified PCR product with SacI and BamHI enzymes
Pipette carefully and accurately the following reagents into one 0.5 mL Eppendorf
tube (label the tube with your initials):
Reagent
Purified amplicon
CutSMart Buffer 10x
SacI enzyme
SamHI enzyme
Water
Volume/ µL
10 µL
2 µL
1 µL
1 µL
6 µL -> total reaction volume 20 µL
Incubate at 37°C in the hotplate for 30 min, then deactivate the enzyme at 65 °C for
10 min.
Ligation of the PCR amplicon and the digested vector
Ligation involves the formation of phosphodiester bonds between adjacent 5’phosphate and 3′-hydroxyl residues; it is catalyzed by bacteriophage T4 DNA ligase.
8
Pipette carefully and accurately the following reagents into one 0.5 mL Eppendorf
tube (label the tube with your initials):
Reagent
Digested plasmid DNA – pDL05
Purified PCR amplicon
Ligation Buffer
T4 ligase
Water
Volume/ µL
1 µL
4 µL
1 µL
1 µL
3 µL
The reaction will be incubated at room temperature until the next laboratory session.
9
Laboratory 3: Transformation of the ligation mixture in lambda pir
E. coli competent cells
Materials needed:
–
Lambda pir E. coli competent cells
LB agar plates containing Ampicillin (100 μg/ml)
1. Place the ligation mixture on ice.
2. Thaw on ice, two 50 μL vials of the competent cells for each ligation.
3. Pipette 5 μL of ligation reaction directly into the vial of competent cells and
mix by tapping gently. Do not mix by pipetting up and down. Label the
tube with your initials.
4. Incubate the competent cells and the ligation mixture on ice for 15 min
5. Heat shock the vial with cells and the ligation mixture in the water bath set
to 42°C for 45 s and then move the tube on ice and keep it on ice for 1 min
6. Spread your transformed cells on two pre-warmed, labelled LB agar plates
(each containing 100 μg/mL ampicillin)
7. Incubate the plates at 37°C overnight.
Record the results
10
Laboratory 4 Screening for recombinant clones by colony PCR and
agarose gel electrophoresis
Colony PCR is a method used to screen for plasmids containing a desired insert
directly from bacterial colonies without the need for culturing or plasmid purification
steps
Protocol
1. Pick a colony from the transformation plate
2. Perform the PCR using suspended E. coli cells as the template
Pipette carefully and accurately the following reagents into one 0.5 mL Eppendorf
tube (label the tube with your initials):
Reagent
Template
PCR Mastermix 2x
Primer Forward 10 µM
Primer Reverse 10 µM
Water
Volume/ µL
Pick a colony and suspend in PCR mix
10 µL
1 µL
1 µL
8 µL
3. Mix all reagents by pipetting the liquid up and down using the micropipette and
centrifuge the tube briefly to move all the liquid to the bottom of the tube
4. Place your tube into the thermocycler. Using the following settings:
Initial denaturation for 3 min at 95˚C and 35 cycles of:
40 s at 95˚C
30 s at 63˚C
30 s at 72˚C
and the final extension for 7 min at 72˚C
11
(a) Gel electrophoresis
Preparation of the agarose gel
1. You will be provided with 35 ml of molten 1.5% agarose to which the dye Gel Red
has been added. This dye is a safer alternative to ethidium bromide for DNA staining.
The dye stains the DNA by intercalation between the base pairs and allows the
bands to be visualised under UV light. Pour the molten agarose into the gel
apparatus (make sure end plates and comb are firmly in place). Leave to set on the
bench.
2. When the agarose is set, pour 50 ml gel running buffer (TBE) onto the top of the gel.
Remove the end plates and comb and stand the gel on a sheet of black paper. Do
not move the gel once you have started loading your samples.
Preparation of the samples and loading the gel
3. Add 5 μl bromophenol blue loading dye to your PCR tube and mix gently
4. Briefly centrifuge the PCR tubes to ensure the blue liquid is at the bottom
5. Using a P200 pipette collect 25μl of sample. Load the 25μl sample into the required
well of the gel. Use the central 6 wells for the samples.
6. Load 20l DNA markers into the two outer wells of the gel. The markers are a
mixture of DNA fragments of known size which will allow you to determine the size of
your PCR products.
7. Connect the gel to the power pack and run for about 60 min at 100mA per gel.
Visualisation of DNA bands
5. At the end of the electrophoresis run, turn off the power pack.
6. Tip the running buffer into the waste container.
7. Place the gel (removed from the tank) into the transiluminator. Visualize the bands
and cut out the desired product using the sharp scalpel.
Record your results
12
School of Life Sciences Assessment Brief Academic Year 2021-22
Section 1: Key information
Module Code
7003BMS
Module Name
Industrial and Environmental Biotechnology
Semester
2
Status
Resit
Module Leader
Tim.aldsworth@coventry.ac.uk
Assessment Title
CW2
Core /Applied Core
Applied Core
Credit weighting
10
Group/Individual
Individual
assessment
Task outline
Unless advised otherwise, for this resit (referred) assessment,
you are required to make a substantive improvement to your
original submission, following the advice and guidance given
in your original feedback.
Your task, as for the original submission, is to produce a
poster presentation of a bioremediation/ biofuel laboratory
study undertaken in weeks 5, 6, 8, 9, 10, 11.
Submission
Poster online submission deadline online Mon 4th April 2022
deadline/attendance date by 18:00hrs BST.
You will also be required to present your poster in person on a
day and time to be arranged during week 12 (w/c 4/4/22).
Posters will be presented onscreen using PowerPoint.
No grace period applies to this assignment, since this is a
timed assessment on a specified day.
Submission/attendance
You must must attend on campus to present your poster.
instructions
You must also submit your poster via the Turnitin link in Aula.
Word or time limit
Your poster must fit on a single PowerPoint slide. Anything
exceeding 1 PowerPoint slide will not be read.
Your presentation must take no more than 5 minutes, and will
be followed by 5 minutes of questioning.
If you exceed the time limit for presenting your poster by more
than 10% (ie if you exceed 5 ½ minutes) then you will be
penalised by deduction of 10% of your final mark.
Presentations that continue to more than 30% extra time will
be halted and you will not be permitted to finish.
Special instructions
By submitting/ attending this assessment you are declaring
yourself fit to do so. If you are not fit to submit/ attend at this
time you may apply for deferral to the next assessment period
(see Extension and Deferral request instructions). Please
note that extensions to the deadline are NOT applicable for
this assessment.
By submitting this assessment you agree to the following statement:
I confirm that this CW submission represents my own work, and I have not received
any unauthorised assistance. I understand the rules around plagiarism, collusion
and contract cheating and that it is my responsibility to act with honesty and
integrity in the assessment process. I understand that there will be no tolerance
towards academic dishonesty, and that cheating can and will lead to serious
consequences.
Section 2- Detail of the Assessment task
The assessment information from the original assessment brief is repeated below. Ensure
that you access and read fully the feedback on your original submission and are clear
about the improvements that are necessary to meet the Learning Outcomes. If you are
unsure, contact the module leader for advice.
You are required to prepare and present a conference-standard poster reporting a
laboratory investigation into anaerobic digestion that you have undertaken during this
module.
Your poster should present a brief note of the background to the work that you have
undertaken, the methods that you employed, the results that you observed, and the
conclusions that you have drawn from them.
Your poster presentation must fit onto one side of an A0 sheet of paper.
You will be required to give an oral summary of your poster in person, and you will then be
required to answer questions on the content of your poster and presentation.
Detail of submission/ attendance instructions
A DRAFT Turnitin link is available in the Course Community Aula site to allow you to check
your similarity score prior to making your final submission. You may submit multiple times
to this link, but do remember that obtaining a similarity report may take up to 24 hours.
The FINAL Turnitin link on the module Aula page (labelled as 7003BMS CW2 Poster
Presentation FINAL resit submissions) is for submission of your work for assessment. You
may submit only ONCE to this link. Remember that submission make take some time to
complete, so aim to submit several hours before the deadline. The TurnitinUK system will
record the date and time of your submission and cannot be over-written.
Please convert your final submission to a PDF format as these suffer less from formatting
changes.
If you experience any technical problems when trying to submit your work, please consult
Aula help via the question mark link. If these problems are experienced at the time of the
submission deadline and cannot be quickly resolved, please capture screenshots as
evidence and email these and your completed assessment to the module leader asap.
Word count details
The following are included in your word allowance:
Not applicable
The following are excluded from your word allowance:
Not applicable
Section 3: Help and Support
 You will find laboratory schedules and workshop resources for the laboratories and the
poster presentation workshop on the 7003BMS module pages on Aula.
 Please read carefully the feedback and advice that is given to you on the poster
presentation feedback sheet, and use this as the basis for the improvements that you
make to your poster presentation.
 You are encouraged to book an appointment with the ML to review you initial
submission so that you are clear about the improvements required.
If you have a special requirement such as a variation of assessment need please contact
the disabilities team.
Links to additional
assessment information
Section 4: Learning Outcomes and Marking Rubric
Mapping to module
This assessment is designed to assess Learning Outcomes 1,
Learning outcomes
2, 3 of the module:
Mapping to course
Learning Outcomes
Task type/scheduling
rationale
Indicative marking criteria:
1.
Critically review a current topic in environmental or
industrial biotechnology
2.
Conduct, record and critically interpret laboratory
investigations, applying appropriate data analysis software.
3.
Design and defend, in a conference style setting, a
poster detailing experimental research.
This assessment relates to the following Course Learning
Outcomes:
1.
Demonstrate an understanding of a number of aspects
of biotechnology and apply knowledge to problem based
scenarios.
2.
Critically analyse and synthesise scientific information
in the subject area of biotechnology and articulate and present
this effectively, through written, oral and digital formats, to a
diverse and global audience.
3.
Competently undertake laboratory work using a wide
range of biotechnological techniques and analyse resulting
data effectively.
4.
Work effectively within a team and demonstrate
creativity and leadership skills.
The purpose of the MSc Biotechnology is to develop wellrounded and confident professional scientists capable of
communicating with differing audiences using appropriate
media. Consequently, this assignment asks students to
present information about their science in a professional, but
precise, manner as they might be asked to do for a poster
presentation at a scientific conference.
Criteria
Grading
Poster Design
Content
Poster Presentation
Defence of Poster
20%
50%
10%
20%
(Outstanding/
Excellent)
Distinction
72, 75, 78,
82, 85, 88,
90, 95, 100
The poster is of
conferencepublishable standard
without any further
work.
The poster is logically
presented utilising a
coherent style
throughout that
employs an excellent
mixture of text,
figures/ images, and
colour to present
information with
impact. It is written in
a concise, succinct
style, using a
professional standard
of Scientific English
and appropriate
terminology.
References and
citation style utilises
correct APA
referencing style, with
all claims being
supported.
The introduction to the
poster is excellent. It
synthesises a wide
range of up-to-date
literature to give the
background to the
work undertaken and
to present a clear yet
subtle justification for
it.
The poster gives an
appropriate amount of
detail regarding the
methods used, and
may use figures/
images to help do this
so that it is succinct, so
that another worker
could repeat the work
without having to
“read between the
lines” to guess what
was done. The poster
presents data that
have been fullysynthesised and
analysed, with no raw
data or intermediate
calculations presented,
unless this is essential
to the presentation.
The data have been
fully analysed using
appropriate statistical
techniques, and are
presented to a
professional standard
in figures or tables as
appropriate.
The discussion and
conclusions give an
excellent
interpretation of the
data with subtle
comparison with the
wider literature to help
justify the points
made. Suggestions for
future work are
insightful, and
demonstrate an
excellent
understanding of how
the data relate to the
wider literature and
therefore what impact
they have on our
understanding of the
topic.
The oral presentation
of the poster is of a
standard that would
be seen at a
conference. The
presentation is
confident, clear and
knowledgeable. The
presentation covers all
of the relevant aspects
of the research
presented in the
poster, and allocates
an appropriate amount
of time to its
description of each
aspect of the poster.
Able to answer all
questions relating to
the work presented in
the poster, without
requiring any
prompting or hints.
Shows an excellent
understanding of how
the work is justified
with reference to the
wider literature.
Shows an excellent
understanding of the
experimental
techniques used, and
can justify the use of
these particular
techniques over any
possible alternatives.
Shows an excellent
understanding of how
the raw data have
been analysed to
generate the data
presented, and can
justify the calculations
(eg statistical analyses)
used. Can clearly draw
comparisons between
the wider literature
and the data
presented, and can
demonstrate how the
work has “added to
the sum total of
human knowledge”.
Can suggest subtle and
insightful avenues for
further work on the
basis of the data
generated.
(Very Good)
Merit
62, 65, 68
The poster would be
appropriate for
presentation at
conference given a
little editing and
“tidying up”.
Relationships between
statements and
sections are generally
easy to follow. Overall
writing style and
structure is good but
could have been more
concise. Standard of
Scientific English is
good and generally
uses the correct
terminology. Overall
structure and
formatting is good,
employing a generally
appropriate mixture of
text, figures/ images,
and colour to present
information, however
design could have
been further refined to
improve impact
References and
citation style generally
correct and use APA
referencing style.
The introduction to the
poster is generally very
good. It synthesises a
good range of up-todate literature to give
the background to the
work undertaken and
to present a good
justification for it.
The poster generally
gives an appropriate
amount of detail
regarding the methods
used, and might use
figures/ images to help
do this, so that
another worker could
repeat the work
without having to do
much “reading
between the lines” to
guess what was done.
The description of the
methods may be a
little more verbose
than is necessary. The
poster presents data
that have mostly been
properly-synthesised
and analysed, with
very little raw data or
intermediate
calculations presented,
unless these are
essential to the
presentation. The data
have generally been
fully analysed using
appropriate statistical
techniques, and are
presented to a very
good standard in
figures or tables as
appropriate.
The discussion and
conclusions give a very
good interpretation of
the data with subtle
comparison with the
wider literature to help
justify the points
made. With simplistic
allusions being made
only very occasionally.
Suggestions for future
work are generally
insightful, and
demonstrate a very
good understanding of
how the data relate to
the wider literature,
but might occasionally
miss key points.
The oral presentation
of the poster is
generally of a standard
that could be seen at a
conference, and would
only need a little bit of
revision and practice
to bring it up to this
standard. The
presentation is
generally confident,
clear and
knowledgeable. The
presentation generally
covers all of the
relevant aspects of the
research presented in
the poster, although it
might omit one or two
small points that don’t
significantly impact
upon the audience’
understanding of the
poster content. The
presentation generally
allocates an
appropriate amount of
time to its description
of each aspect of the
poster; it may put a
little too much
emphasis on a slightly
less important element
but this does not
detract from the
presentation of the key
content.
Able to answer all or
most questions
relating to the work
presented in the
poster, but with
perhaps the occasional
prompt or hint.
Shows a good
understanding of how
the work is justified
with reference to the
wider literature, but
with perhaps the very
occasional misunderstanding. Shows
a good understanding
of the experimental
techniques used, and
can largely justify the
use of these particular
techniques over any
possible alternatives.
Shows a good
understanding of how
the raw data have
been analysed to
generate the data
presented, and can
largely justify the
calculations (eg
statistical analyses)
used. Can largely draw
comparisons between
the wider literature
and the data
presented, and
demonstrate how the
work has “added to
the sum total of
human knowledge”.
Can suggest
appropriate avenues
for further work on the
basis of the data
generated.
(Good)
Pass
52, 55, 58
With some editing,
restructuring and
correction, the poster
could be brought up to
conference standard.
Relationships between
statements and
sections are
sometimes hard to
follow or not fully
articulated. Writing
style is acceptable but
requires work to
ensure work is concise
and not repetitive.
Scientific English needs
further development.
Some inappropriate
terminology has been
used. Formatting
shows some
inconsistences and
overall design is
simplistic and text
heavy. Use of figures/
images and colour is
largely appropriate,
but some
improvement is
needed.
References are
generally presented
using the correct style,
but not all of the
material included is
supported by the
literature.
The introduction to the
poster is generally
good. It synthesises a
good range of
literature, most of
which is up-to-date, to
give the background to
the work undertaken
and to present a
generally good
justification for it.
The poster gives an
appropriate amount of
detail regarding the
methods used, and
could use some
figures/ images to help
do this, so that
another worker could
repeat the work with
only a little “reading
between the lines” to
guess what was done.
The description of the
methods is more
verbose than is
necessary. The poster
presents data that
have mostly been
properly-synthesised
and analysed, but may
include some raw data
or intermediate
calculations. The data
have should be
analysed using
statistical techniques,
but these may not
always be appropriate.
The data are generally
presented to a good
standard in figures or
tables, but these may
be lacking in some
respects (eg poor or
missing titles/ labels/
legends).
The discussion and
conclusions give a
good interpretation of
the data and include a
reasonable comparison
with the wider
literature. Some of the
comparisons with the
literature may be
simplistic, or missing
from the discussion.
Suggestions for future
work have been made,
and should
demonstrate a good
understanding of how
The oral presentation
of the poster falls a
little short of what
would be seen at a
conference, but only
limited revision and
practice would be
required to bring it up
to conference
standard. The
presentation is quite
confident, clear and
knowledgeable,
overall, although there
may be a little
confusion over some
aspects of the content.
The presentation
covers most of the
relevant aspects of the
research presented in
the poster, although it
might omit some
points that would
impact a little upon the
audience’
understanding of the
poster content. The
presentation mostly
allocates an
appropriate amount of
time to its description
of each aspect of the
poster. However,
there may be a little
too much emphasis on
some of the less
important elements of
the poster, with the
omission of a small
amount of the key
content.
Able to answer most
questions relating to
the work presented in
the poster, but may
need the occasional
prompt or hint to help
do this.
Shows a generally
good understanding of
how the work is
justified with reference
to the wider literature,
but may demonstrate
occasional misunderstandings.
Shows a generally
good understanding of
the experimental
techniques used, and
can mostly justify the
use of these particular
techniques although
may occasionally not
be able to do so.
Shows a generally
good understanding of
how the raw data have
been analysed to
generate the data
presented, and can
mostly justify the
calculations (eg
statistical analyses)
used but may
occasionally not be
able to explain why
particular technique
has been used. Can
mostly draw
comparisons between
the wider literature
and the data
presented, and can
demonstrate to some
extent how the work
has “added to the sum
total of human
knowledge”. Can
suggest appropriate
avenues for further
work on the basis of
the data generated,
but may need hints to
do this.
Criteria
Grading
Poster Design
Content
Poster Presentation
Defence of Poster
20%
50%
10%
20%
the data relate to the
wider literature, but
might be missing key
points.
(Acceptable)
Pass
42, 45, 48
The poster would need
a considerable amount
of editing and rewriting before it could
be presented to a
conference.
Relationships between
statements and
sections are
sometimes unclear.
Poor writing style;
repetitive, with a
general lack of correct
terminology. Poster
lacks required
structure, with limited
flow and coherence.
Design is poorly
executed and generally
lacking visual impact.
Use of figures/ images
and colour is mostly
appropriate, but
improvement is
needed.
Referencing style
incorrect or contains
numerous formatting
issues.
The introduction to the
poster is adequate to
reasonably good. It
synthesises an
adequate range of
literature, some of
which is up-to-date, to
give at least some of
the background to the
work undertaken and
will present some
justification for it.
The poster gives an
adequate amount of
detail regarding the
methods used, but is
likely to rely on text
only and to be rather
verbose, so that
another worker could
only repeat the work
by doing some
“reading between the
lines” to guess what
was done. The poster
presents some data
that have been
properly-synthesised
and analysed, but also
includes raw data and/
or intermediate
calculations. The data
may have been
analysed using
statistical techniques,
but these might not be
appropriate or
sufficient. The data
are presented to a
good standard in some
figures or tables, but
some may be lacking in
some respects (eg poor
or missing titles/
labels/ legends).
The discussion and
conclusions give an
adequate
interpretation of the
data and include some
comparison with the
wider literature. Some
of the comparisons
with the literature may
be simplistic, or
missing from the
discussion. The
discussion does not
always cite literature
to support points
made. A few
suggestions for future
work have been made,
The oral presentation
of the poster falls
somewhat short of
what would be heard
at a conference, and
would require an
appreciable amount
revision and practice
to bring it up to
conference standard.
The presentation is
reasonably clear and
knowledgeable, but
may be lacking in some
confidence. In
addition, there may be
some confusion over
some aspects of the
content. The
presentation covers
some of the relevant
aspects of the research
presented in the
poster, but omits a few
points that are
required for the
audience to
understand the poster
content fully. The
presentation covers
the appropriate
aspects of the poster,
but focusses in a little
too much detail on less
relevant areas and
insufficiently on the
key areas of the
poster.
Able to answer an
adequate proportion
of the questions
relating to the work
presented in the
poster, but may need
some prompts or hint
to help do this.
Shows an adequate
understanding of how
the work is justified
with reference to the
wider literature, but
may demonstrate
some misunderstandings.
Shows an adequate
understanding of the
experimental
techniques used, and
can sometimes justify
the use of these
particular techniques
although may
sometimes not be able
to do so. Shows an
adequate
understanding of how
the raw data have
been analysed to
generate the data
presented, and can
generally justify the
calculations (eg
statistical analyses)
used but may
sometimes not be able
to do so. Can generally
draw comparisons
between the wider
literature and the data
presented, but may
need prompts or hints
to demonstrate how
the work has “added
to the sum total of
human knowledge”,
and sometimes may
not be able to do so.
Can generally suggest
appropriate avenues
for further work on the
basis of the data
generated, but may
not always be able to
do so.
Criteria
Grading
Poster Design
Content
Poster Presentation
Defence of Poster
20%
50%
10%
20%
but these only
demonstrate an
adequate
understanding of how
the data relate to the
wider literature, and
are likely to be missing
one or two key points.
Fail
0, 10, 20, 30,
35
The poster would need
significant amounts of
editing, or a total rewrite, before it could
be presented to a
conference.
There are few clear
links between
statements or sections.
Extremely poor writing
style. Inappropriate
terminology. Little or
no attempt to provide
the required format or
design. Use of figures/
images and colour is
inappropriate or only
occasionally
appropriate, and
significant
improvement is
needed. Little or no
reference is made to
supportive evidence.
Referencing style is
incorrect.
The introduction to the
poster is poor or nonexistent. Only a
limited body of, or no,
literature has been
used to give the
background to the
work undertaken. The
work undertaken has
not been justified, or
the justification is very
limited. The
introduction is of
limited, or no
relevance, to the work
undertaken.
The poster gives
insufficient, or no,
detail regarding the
methods used, so that
another worker could
only repeat the work
with significant
“reading between the
lines” to guess what
was done. The
description of the
methods is much more
verbose than is
necessary. The poster
presents mostly raw
data, or no relevant
data. The data have
not been analysed
using appropriate
statistical techniques.
The data are presented
only in text, or only in
inappropriate or
unclear figures/ tables.
The discussion and
conclusions give either
a weak, or no,
interpretation of the
data. The discussion
and conclusion make
little, or no,
comparison with the
wider literature, or do
not use appropriate
literature to support
points made. Any
comparisons with the
literature that are
made are simplistic.
Suggestions for future
work are either
simplistic (eg use a
different pipette, or
perform more
replicates) or are
missing altogether.
The oral presentation
of the poster is very
poor, or is not done.
The presentation
would require a
significant amount of
revision and practice
to bring it up to an
adequate standard, if
that is possible at all.
The presentation is
unclear, confused and
betrays a serious lack
of understanding of
the content. The
presentation will be
weak and lacking in
confidence. The
presentation may
cover a few of the
relevant aspects of the
research presented in
the poster, or it may
bear no relation to the
poster content at all,
and so will lead to
significant confusion
for the audience. The
presentation may
cover only a few
aspects of the poster,
or it may not present
the poster content at
all.
Unable to answer
questions about the
work presented, or
only able to answer
the occasional
question, with or
without prompts or
hint to help do this.
Answers are short and
simplistic.
Shows no, or only
limited, understanding
of how the work is
justified with reference
to the wider literature.
Shows no, or limited,
understanding of the
experimental
techniques used, and
struggles justify the
use of these particular
techniques. Shows no,
or limited,
understanding of how
the raw data have
been analysed to
generate the data
presented, and
struggles to justify the
calculations (eg
statistical analyses)
used. Struggles to
draw comparisons
between the wider
literature and the data
presented. Struggles
to suggest avenues for
further work –
appropriate or
otherwise – on the
basis of the data
generated.
Section 5: Marks return and feedback
Marking and moderation This assignment brief has been moderated by a member of
Information
academic staff outside the module team.
As this is a RESIT submission, anonymous marking is not
possible as the marker will wish to access your original
submission and feedback advice. Please ensure that you add
your name to your script. Marking will be completed by
academic staff, which may include hourly paid staff. The
marking will then be moderated by a member of the module
team and reviewed by an academic staff member outside the
team. The module feedback and marks will then be
moderated by the external examiner.
Your mark will be reported as a banded mark according to the
School’s banded marking guidelines.
Feedback and return of
All banded marks released are subject to final Progression and
marks
Awards Board decisions and are therefore provisional until after
the Board sits.
Provisional marks will be released on 21st April 2022 via the
Aula site in the Student Success App.
Feedback comments can be accessed by clicking on your
submission in Turnitin and selecting the comments icon. The
completed marks rubric can be accessed through the rubric
icon.
If you have any questions about your feedback, contact the
module leader.
Following the Progression and Awards Board, your marks will
be confirmed, and you will be able to view your final grades
through SOLAR together with information on any resit or deferral
arrangements. If you require further clarification, contact your
Course Director or Faculty Registry.
Section 6: General Information
Penalties for late/nonWork that is submitted late, without an extension or deferral
submissions
having been granted, will receive a mark of ZERO (students
will normally be eligible for a resit attempt).
Extension and Deferral
requests
Work that is not submitted or tests/exams etc not attended,
without an extension or deferral having been granted, will be
recorded as Absent (ABS). In these cases it is at the
discretion of the Progression and Awards Board as to whether
you will be permitted a resit attempt.
If you are unable to submit coursework or attend an
assessment e.g. test, examination, presentation or assessed
laboratory session, you may be eligible to apply for a deferral.
Please refer to the Extenuating Circumstances guidance on
the Student Portal.
Deferral or Extension requests must be made before the due
date of the assignment and must be accompanied by
appropriate evidence. Please be aware that deferral of an
assessment may affect your ability to progress into the
next academic year of study, therefore you are advised to
seek advice from your tutor or course director if you are
considering deferring an assessment.
Reference formatting
SLS banded marking
scheme
Academic Integrity
Coventry University now uses the APA Referencing Style.
However, if you started your course before 1st September
2020, you may continue to use the Coventry University Guide
to Referencing in Harvard Style until you graduate. For
support and advice on how to reference appropriately please
see the online referencing guidance or contact your Academic
Liaison Librarian.
The SLS banded marking approach recognises that marking
cannot be exact and avoids students being awarded marks
that lie close to a grade boundary.
The banded marks that may be awarded are as follows:
Outstanding
82, 85, 88, 90, 95, 100
Excellent
72, 75, 78
Very Good:
62, 65, 68
Good
52 ,55, 58
Acceptable
42, 45, 48
Fail (does not meet LOs) 0, 10, 20, 30, 35
Academic dishonesty hurts everyone in the community. It not
only damages your personal reputation, but also the reputation
of the entire University, and it will not be tolerated at Coventry
University. It is in the best interest of all students for the
University to maintain the good reputation of its awards. Your
co-operation is expected in actively protecting the integrity of the
assessment process. It is your duty to observe high personal
standards of academic honesty in your studies and to report any
instances of malpractice you become aware of, without fail.
We expect students to act with academic integrity, which means
that they will study and produce work in an open, honest and
responsible manner. It is important, therefore, that you
understand fully how to avoid academic misconduct and where
to obtain support. Academic dishonesty covers any attempt by
a student to gain unfair advantage (e.g. extra marks) for
her/himself, or for another student, in ways that are not allowed.
Examples of such dishonesty include:
 Collusion includes the knowing collaboration, without
approval, between two or more students, or between a
student(s) and another person, in the preparation and
production of work which is then submitted as individ…

Order an Essay Now & Get These Features For Free:

Turnitin Report

Formatting

Title Page

Citation

Outline

Place an Order