Assignment 20 – Transcription and TranslationThis is similar but different than assignments 7 and 11. Think of this as a cumulative assignment showing me what you know and understand about
Replication, Transcription and Translation. Please make sure you read it all thoroughly. Some instructions and assumptions have changed. You
need to work through this carefully. Show all of your work. (20 points)
DNA Replication.
Below is a section of single-stranded DNA that was just isolated from a population of bacteria just found on Mars. We will call this the normal allele
or wild-type allele.
5’–TTGCCCAAATGTATACCATCATGGAATTTCTTATAGAGTCATTCGCATCGACATAACACAGCTTGAGCTGCAGGCCATACTACCGTAAGAT–3’
1. If this piece of DNA were to be a template during DNA replication, what would the resulting double-stranded DNA look like? Assume that
everything works on Mars just like on Earth unless you are told differently. Replicate it properly and show all important components of
both DNA strands. Type it out so you do not make a mistake and I can read it.
2. At the 3’ end of all DNA and RNA there is a functional chemical group. What is its significance to DNA replication?
3. In a cell, many enzymes work in an ordered way to make DNA replication possible. One enzyme in particular would be needed to replicate
this piece of DNA in the cell. It is the same process that is provided by a researcher supplying primers when PCR is performed. What is the
enzyme? Explain the role of the enzyme in the cell and how it does its job.
4. One allele of DNA that is found in the population has the AC nucleotides (bold above) mutated to GA. Type the double-strand piece of DNA
that would be responsible for this allele. Type it out so you do not make a mistake and I can read it. We will call this allele AC to GA allele.
5. A third allele that is found in the population has the single C nucleotide (underlined above) deleted. It is totally missing, but all of the rest of
the DNA is present. Type the double-strand piece of DNA that would be responsible for this allele. Type it out so you do not make a mistake
and I can read it. We will call this allele C allele.
1
Transcription.
You will be working with all three of the different alleles that you created above; wild-type (normal), AC to GA, and C. All three alleles use the top
DNA strand as their coding strand. There is no promoter, so just start transcribing from the beginning of the correct strand. Type the RNA that
results with the 5’ at the left of the paper.
6. Provide the primary transcript that results from the wild-type allele. Type it out so you do not make a mistake and I can read it.
7. Provide the primary transcript that results from the AC to GA allele. Type it out so you do not make a mistake and I can read it.
8. Provide the primary transcript that results from the C allele. Type it out so you do not make a mistake and I can read it.
9. What enzyme is responsible for creating these primary transcripts? Briefly describe how this enzyme works in the cell.
10. In question #3 above there is a requirement for a functional chemical group at the 3’ to initiate DNA Replication. Does initiation of
transcription require the same functional chemical group for RNA Replication? Explain.
2
mRNA Processing.
You will be working with all three of the primary transcripts that you created above; wild-type (normal), AC to GA, and C. Splicing of the primary
transcript is one modification required to make mature mRNA in eukaryotes. Type the mRNA that results with the 5’ at the left of the paper.
On Mars, Splicing enzymes recognize the 5’ end of introns that have the following sequence: UUU|CUU where the bold letters are the exon and the
regular letters are intron. Splicing enzymes recognize the 3’ end of introns that have the following sequence: UUC|GCA where the bold letters are
the exon portion and the regular letters are intron. The | is used to show the separation of the exon and the intron at both ends of the intron.
Exons are bold, introns are not.
11. Provide the mature mRNA that results from the primary transcript of the wild-type allele when it undergoes splicing. Type it out so you do
not make a mistake and I can read it.
12. Provide the mature mRNA that results from the primary transcript of the AC to GA allele when it undergoes splicing. Type it out so you do
not make a mistake and I can read it.
13. Provide the mature mRNA that results from the primary transcript of the C allele when it undergoes splicing. Type it out so you do not
make a mistake and I can read it.
14. Splicing is one modification that occurs to a primary transcript. Name and describe one other process that happens to primary transcripts
to make them mature mRNAs.
15. Splicing and what you wrote in #14 above are two modifications that occur to a primary transcript. Name and describe one other process
that happens to primary transcripts to make them mature mRNAs.
3
Translation.
You will be working with all three of the mature mRNA transcripts that you created above; wild-type (normal), AC to GA, and C. Type the
polypeptide that results with the amino terminus at the left of the paper.
16. Provide the polypeptide that results from the mature mRNA of the wild-type allele. Type it out so you do not make a mistake and I can read
it.
17. Provide the polypeptide that results from the mature mRNA of the AC to GA allele. Type it out so you do not make a mistake and I can read
it.
18. Provide the polypeptide that results from the mature mRNA of the C allele. Type it out so you do not make a mistake and I can read it.
19. What functional chemical group is always found at the right of a polypeptide when written on this paper? What is its importance to the
polypeptide?
20. Look at all three polypeptide chains. There should be some differences if you did this assignment correctly. You might find it helpful to use
the one letter amino acid code if you have not already done so. Reflect on the importance of all of the enzymes used from DNA through
Protein to work with high-fidelity (they do their job correctly without making mistakes).
4
Bonus.
This is not required. If you choose to do this and get it correct, I will add up to three bonus points to this assignment. Your score will not go above
20 points for this assignment.
Many proteins/enzymes in our cells are made up of multiple polypeptides (Quaternary structure) and are required to be this way to function
correctly. An example is hemoglobin which has four polypeptides; two of the polypeptides are from one gene and two are from a different gene.
They all come together correctly to allow us to transport oxygen from our lungs to the cells in our body so that the oxygen can be used to make ATP
in cellular respiration.
Look at the wild-type and C polypeptide chains you created above. Assume that they are used in the cell to create an essential enzyme that
allows a cell to live. We will call this enzyme Trouble. One of these polypeptides comes from a gene you inherited from your mother and the other
comes from the gene you inherited from your father. After translation, two polypeptide chains come together in the cell to make the Trouble
enzyme function.
21. Imagine what the outcome might be if you had both the wild-type and C alleles in your DNA at the same time; one from mom and one
from dad. How many different types of Trouble enzyme could be created (base this on only the information given here)? Explain. What do
you think the outcome for the cell would be? Explain.
5
6
7
Order an Essay Now & Get These Features For Free:
Turnitin Report
Formatting
Title Page
Citation
Outline
