Pleasereadandreviewboth Zhai et al. research article. After reading the original research article, please answer the following questions and compete the tasks for your assigned article
Questions:
- Create 3 alternative titles for the article you reviewed (assigned). Then, highlight which title you think is the best one.
Hint: Effective titles in academic research papers have several characteristics.
- Indicate accurately the subject and scope of the study.
- Avoid using abbreviations.
- Use words that create a positive impression and stimulate reader interest.
- Use current nomenclature from the field
- Write an alternative abstract in your own words. Max 300 words.
See youtube for advice on writing research abstracts, such as:
https://blog.wordvice.com/how-to-write-a-research-…
https://www.youtube.com/watch?v=8_icGm2r3eU&ab_channel=UofGStudentLearningDevelopment (Links to an external site.)
https://www.youtube.com/watch?v=sxixLYBtBH0&ab_channel=RanywayzRandom (Links to an external site.)
https://study.com/academy/lesson/how-to-write-a-scientific-abstract.html (Links to an external site.)
- Provide 5 keywords for the article you reviewed.
Hint: Keywords are generally 1 word or accepted saying and allow search engines to pinpoint the article.
- Provide 5 questions that may be asked to the “Graduate student presenter” and classmates during Journal Club.
Hint: Keep questions within scope of the research article experiments, results (data) and conclusions. Also, keep them short and to the point.
GENETICS AND MOLECULAR BIOLOGY
The OxrA Protein of Aspergillus fumigatus Is Required for the
Oxidative Stress Response and Fungal Pathogenesis
Pengfei Zhai,d Landan Shi,a Guowei Zhong,c Jihong Jiang,a Jingwen Zhou,a Xin Chen,a Guokai Dong,a Lei Zhang,b Rongpeng Li,a
Jinxing Songa
The Key Laboratory of Biotechnology for Medicinal Plants of Jiangsu Province and School of Life Science, Jiangsu Normal University, Xuzhou, Jiangsu, China
a
Shandong Provincial Key Laboratory of Infection and Immunity, Jinan, China
b
c
Center for Global Health, School of Public Health, Nanjing Medical University, Nanjing, China
Jiangsu Key Laboratory for Microbes and Functional Genomics, Jiangsu Engineering and Technology Research Centre for Microbiology, College of Life Sciences,
Nanjing Normal University, Nanjing, China
d
ABSTRACT An efficient reactive oxygen species (ROS) detoxification system is vital
for the survival of the pathogenic fungus Aspergillus fumigatus within the host highROS environment of the host. Therefore, identifying and targeting factors essential for
oxidative stress response is one approach to developing novel treatments for fungal
infections. The oxidation resistance 1 (Oxr1) protein is essential for protection against
oxidative stress in mammals, but its functions in pathogenic fungi remain unknown.
The present study aimed to characterize the role of an Oxr1 homolog in A. fumigatus.
The results indicated that the OxrA protein plays an important role in oxidative stress
resistance by regulating the catalase function in A. fumigatus, and overexpression of
catalase can rescue the phenotype associated with OxrA deficiency. Importantly, the
deficiency of oxrA decreased the virulence of A. fumigatus and altered the host
immune response. Using the Aspergillus-induced lung infection model, we demonstrated that the DoxrA mutant strain induced less tissue damage along with decreased
levels of lactate dehydrogenase (LDH) and albumin release. Additionally, the DoxrA
mutant caused inflammation at a lower degree, along with a markedly reduced influx
of neutrophils to the lungs and a decreased secretion of cytokine usually associated
with recruitment of neutrophils in mice. These results characterize the role of OxrA in
A. fumigatus as a core regulator of oxidative stress resistance and fungal pathogenesis.
IMPORTANCE Knowledge of ROS detoxification in fungal pathogens is useful in the
design of new antifungal drugs and could aid in the study of oxidative stress resistance
mechanisms. In this study, we demonstrate that OxrA protein localizes to the mitochondria and functions to protect against oxidative damage. We demonstrate that OxrA contributes to oxidative stress resistance by regulating catalase function, and overexpression
of catalase (CatA or CatB) can rescue the phenotype that is associated with OxrA deficiency. Remarkably, a loss of OxrA attenuated the fungal virulence in a mouse model of
invasive pulmonary aspergillosis and altered the host immune response. Therefore, our
finding indicates that inhibition of OxrA might be an effective approach for alleviating
A. fumigatus infection. The present study is, to the best of our knowledge, a pioneer in
reporting the vital role of Oxr1 protein in pathogenic fungi.
KEYWORDS Aspergillus fumigatus, ROS, oxidative stress, fungal pathogenesis
I
ncreasing numbers of invasive fungal infections are being reported recently, most of
which are detected in hospitals (1). Typically, phagocytosis by the innate immune cells
(including neutrophils and macrophages) is the first line of defense against pathogenic
November 2021 Volume 87 Issue 22 e01120-21
Applied and Environmental Microbiology
Citation Zhai P, Shi L, Zhong G, Jiang J, Zhou J,
Chen X, Dong G, Zhang L, Li R, Song J. 2021.
The OxrA protein of Aspergillus fumigatus is
required for the oxidative stress response and
fungal pathogenesis. Appl Environ Microbiol
87:e01120-21. https://doi.org/10.1128/AEM
.01120-21.
Editor Edward G. Dudley, The Pennsylvania
State University
Copyright © 2021 American Society for
Microbiology. All Rights Reserved.
Address correspondence to Rongpeng Li,
lirongpeng@jsnu.edu.cn, or Jinxing Song,
zdsongjinxing@jsnu.edu.cn.
Received 7 June 2021
Accepted 16 August 2021
Accepted manuscript posted online
15 September 2021
Published 28 October 2021
aem.asm.org 1
Downloaded from https://journals.asm.org/journal/aem on 15 April 2022 by 184.177.74.2.
Pengfei Zhai, Landan Shi, and Guowei Zhong contributed equally to this work. Author order was determined on the basis of contribution.
Applied and Environmental Microbiology
fungi in the healthy hosts (2). Inside the immune cells, the generation of the reactive oxygen species (ROS) via the respiratory burst process serves as the primary mechanism
against microbial infections (2–4). The ROS produced within the phagosome damage
key cellular components, such as nucleic acids, lipids, and proteins, inducing programmed cell death (2, 5–7). Therefore, an effective ROS detoxification system plays a
key role in the survival of the pathogenic fungi in such adverse environments. However,
the current understanding regarding the ROS detoxification system of pathogenic fungi
is quite limited, and therefore, it is of great significance to study the ROS detoxification
mechanisms in the pathogenic fungi to identify novel targets for antifungal drugs.
Since the intracellular ROS are produced mainly in the mitochondria (8), the synthesis of numerous proteins that can resist oxidative damage, such as superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPX), occurs within the fungal
mitochondria (2, 9–12). SOD is responsible for converting the superoxide anion free
radicals into hydrogen peroxide (H2O2), while CAT is involved in the detoxification of
H2O2 into oxygen and water. In addition, the induction of these antioxidant proteins
occurs in pathogenic fungi, such as Candida albicans, after exposure to neutrophils
and macrophages, indicating that the defense mechanisms involving such antioxidants
play an important role in the survival of C. albicans during the innate immune cellmediated phagocytosis (13, 14). Indeed, mutations in these antioxidant proteins are
reported to decrease fungal virulence (13, 15, 16). Therefore, ROS-scavenging proteins
are increasingly being acknowledged as putative fungal virulence factors. Since numerous ROS-scavenging proteins are synthesized in the fungal mitochondria, identification
and characterization of these ROS-scavenging proteins in this organelle will be crucial
in understanding how pathogenic fungi avoid host ROS toxicity.
Oxidation resistance 1 (Oxr1) is a conserved gene family that only occurs in eukaryotes and mainly participates in the protection against deleterious ROS (17). The
expression of endogenous Oxr1 protein is induced under oxidative stress conditions in
human cells (18, 19). In many organisms, such as yeast (18, 20), worms (21), mammalian
cells (21–23), mosquito (24), and silkworm (25), the knockout of oxr1 increases the sensitivity to oxidative stress, suggesting that Oxr1 is essential to defend against oxidative
stress. Suppression of Oxr1 protein decreases transcriptional expression of some ROS
detoxification enzymes, indicating that Oxr1 is a regulator of the ROS detoxification
system (17, 22, 24, 26, 27). In conclusion, the antioxidant properties of Oxr1 have been
confirmed in multiple animal and cell models. There are several reports that Oxr1 can
maintain genome integrity (22). In human cells, the deletion of oxr1 increases H2O2induced mitochondrial DNA damage (26). Ectopic expression of human Oxr1 is able to
prevent DNA oxidative damage in the DNA repair-deficient Escherichia coli mutants
(20). Taken together, Oxr1 can prevent the formation of oxidative DNA damage to protect nuclear and mitochondrial genome integrity (21, 28). Additionally, the roles of
Oxr1 also include innate immune defense (27, 29), mitochondrial morphology maintenance (18, 23), and the regulation of aging (19, 21) and the cell cycle (30). Although
the role of Oxr1 in many organisms has been studied extensively, there is little information regarding the role of this protein in fungi. It is well recognized that Oxr1 plays an
important role in coping with oxidative stress, which implies that the Oxr1 protein
might be a virulence factor in pathogenic fungi. However, to date, no homolog of Oxr1
has been identified in pathogenic fungi, including Aspergillus fumigatus and C. albicans.
The genome-wide search for homologs revealed the presence of Oxr1 protein in most
of the pathogenic fungi. Therefore, we explored the role of Oxr1 protein in oxidation
stress response and fungal pathogenesis in the present study, with the findings highlighting the mechanisms of the oxidative stress response and fungal pathogenesis at
the molecular level.
The present work was aimed at identifying and characterizing the Oxr1 homolog of
Saccharomyces cerevisiae in A. fumigatus, the latter being a pathogenic filamentous
fungus. The homolog was named OxrA. It was demonstrated that A. fumigatus OxrA
shares a conserved TLDc domain and plays an essential role in the oxidative stress
November 2021 Volume 87 Issue 22 e01120-21
aem.asm.org 2
Downloaded from https://journals.asm.org/journal/aem on 15 April 2022 by 184.177.74.2.
Zhai et al.
The Role of OxrA in Aspergillus fumigatus
Applied and Environmental Microbiology
RESULTS
In silico identification of S. cerevisiae Oxr1 homolog in A. fumigatus. In order to
identify the putative homolog of Saccharomyces cerevisiae Oxr1 in A. fumigatus, the
BLASTP analysis of the amino acid sequences in the A. fumigatus database with S. cerevisiae Oxr1 as a query identified AFUB_040360 as the best hit (E value, 4e-43; identity,
37.1%). Moreover, the subsequent BLAST analysis against the S. cerevisiae genome
database with the AFUB_040360 sequences as queries revealed Oxrl as the top hit.
These findings suggested that AFUB_040360 sequences and Oxr1 are potential homologs. Thereafter, the AFUB_040360 protein was referred to as OxrA. The full-length
sequencing revealed that OxrA contained 371 amino acid residues and displayed
37.1% sequence similarity to S. cerevisiae Oxr1. The SMART protein analysis revealed
that the estimated topology of OxrA was the same as that of Oxr1, with a single putative TLDc domain starting and ending at positions 123 and 370, respectively, in the
OxrA protein sequence. Previous studies have confirmed the TLDc domain as the protein motif with a high degree of conservation. The TLDc domain is present in certain
mammalian proteins and is capable of resisting oxidative stress (31). In addition, similar
to the S. cerevisiae Oxr1, OxrA also contains a cleavable N-terminal mitochondrial targeting sequence (MITOPROT; http://ihg.gsf.de/ihg/mitoprot.html) for targeting the
inner mitochondrial membrane. A phylogenetic analysis was performed in the present
study to compare the OxrA sequence with the sequences of homologs from several
other fungi and mammals, and the results demonstrated the conservation of the OxrA
amino acid sequence among the strains of Aspergillus spp. (Fig. 1A and B). However,
this conservation in the sequence identity was lower than in the other fungal homologs and mammals and occurred mainly in the conserved TLDc domain (Fig. 1B and C).
In the subsequent investigation of the role of OxrA in A. fumigatus, the entire coding
region of the gene encoding this protein was deleted to generate the DoxrA mutant;
the phenotypic characterization of the deletion mutant and that of a complemented
strain are described below.
OxrA localizes to mitochondria in A. fumigatus. MitoProt was employed to predict the presence of the N-terminal mitochondrial targeting sequence in OxrA (32), and
mitochondria were revealed as the probable location of OxrA. In order to verify the
above finding, a strain containing green fluorescent protein (GFP)-labeled OxrA C terminus was constructed and analyzed. No significant difference was observed in growth
between the OxrA::GFP strain and the corresponding parental strain in both minimal
medium (MM) and complete medium (YAG) media (Fig. 2A). Moreover, there was no
difference in the mRNA level of the constructed strain from that of the parental strain
(Fig. 2B), indicating the full functioning of the OxrA-GFP fusion protein. At 18 h after
germination when cultured in the MM medium, the microscopic observation of the
OxrA protein revealed the predominant colocalization of the GFP-labeled OxrA with
the mitochondrial marker MitoTracker (MitoTracker Red CMXRos; catalog no. M7512)
(Fig. 2C). It has been reported that GFP-tagged MrsA was located in mitochondria in
A. fumigatus (33). To further determine the mitochondrial localization of OxrA, we
constructed two doubly labeled strains derived from OxrA-GFP strain by tagging the C
terminus of MrsA (mitochondrial iron transporter) with red fluorescent protein (RFP).
The dually labeled proteins were functional, and the strains expressing them showed
normal growth phenotypes. Merged fluorescence microscopy studies indicated that
MrsA-RFP mainly colocalized OxrA-GFP in mitochondria (Fig. 2D). Taken together, these
findings confirmed the localization of OxrA in the mitochondria of A. fumigatus, which
November 2021 Volume 87 Issue 22 e01120-21
aem.asm.org 3
Downloaded from https://journals.asm.org/journal/aem on 15 April 2022 by 184.177.74.2.
response. Therefore, oxrA deletion may render the fungal cells susceptible to H2O2induced damage. Moreover, this phenotype was observed to be related to a modulation in catalase activity. Remarkably, a loss of oxrA attenuated the fungal virulence in a
mouse model of invasive pulmonary aspergillosis. In addition, the oxrA mutant modulates activation of the immune system affecting cell influx into the lungs and production of inflammatory cytokine. Taken together, the present study revealed that OxrA is
a core regulator of the oxidative stress response and fungal virulence in A. fumigatus.
Zhai et al.
Applied and Environmental Microbiology
was consistent with the localization of Oxr1 in S. cerevisiae (18), suggesting that the
OxrA protein possibly exerts a certain effect on A. fumigatus mitochondria. Since mitochondria function is required to initiate germination, we investigated the germination
of DoxrA and the wild-type strain, respectively. Our results showed that the germination rate of DoxrA mutant is consistent with that of the wild-type strain, indicating that
OxrA may not be required to initiate germination (Fig. S1 in the supplemental
material).
OxrA is responsible for oxidative stress response in A. fumigatus. In humans, the
Oxr1 protein provides protection against oxidative stress and regulates mitochondrial
function (22, 23). It is well recognized that mitochondria are involved in adaptation to oxidative stress (33, 34), such as exposure to H2O2. Therefore, the next step was to verify
whether the OxrA protein also played an essential role against oxidative stress. The oxrA
null mutant was constructed through homologous recombination by substituting the
open reading frames (ORFs) of oxrA with the selected marker of Neurospora crassa pyr4.
The constructed oxrA deletion strain was named SJX01 (DoxrA). Diagnostic PCRs confirmed
the correct insertion of the pyr4 disruption cassette in the OxrA deletion mutant and the
absence of the original oxrA ORF (Fig. S2). Thereafter, the susceptibility to H2O2 of the deletion mutant was analyzed and compared to its parental strain. Subsequently, the spores of
the mutant were diluted 10-fold in the plates containing the YAG complete medium comprising 3-mM and 5-mM concentrations of H2O2, and the colony growth phenotypes were
observed. The DoxrA strain was observed to be more susceptible to H2O2 treatment than
the parental strain (Fig. 3A). Similar to the colony growth phenotypes detected in the
plates, the DoxrA strain was observed to be hypersensitive to H2O2 relative to the parental
strain in the aqueous medium containing 5 mM H2O2 (Fig. 3B). Moreover, when the
November 2021 Volume 87 Issue 22 e01120-21
aem.asm.org 4
Downloaded from https://journals.asm.org/journal/aem on 15 April 2022 by 184.177.74.2.
FIG 1 Sequence analysis of Oxr1-encoded proteins in fungi. (A) Phylogenic tree of Oxr1 among selected eukaryotes. Amino acid sequences were aligned
using ClustalW, and the phylogenetic tree was constructed via DNAman. (B) Amino acid sequence identity between Oxr1 of A. fumigatus 1163 and
candidate homologs in selected eukaryotes. (C) Conservation of the TLDc domain among Oxr1 homologs.
Applied and Environmental Microbiology
FIG 2 Subcellular localization of OxrA. (A) Colony morphologies of OxrA::GFP and the corresponding
parental strains. The conidia were spotted on minimal medium (MM) and complete medium (YAG)
media for 2 days at 37°C. (B) The relative expression of the oxrA gene was determined by quantitative
PCR in OxrA::GFP and the corresponding parental strains. Gene expression was normalized to the
endogenous reference gene tubA. Experiments were carried out in triplicate. Values are reported as the
means 6 standard deviation (SD). Statistical significance was calculated using the unpaired two-tailed t
test (ns, not significant). (C) Localization pattern of OxrA proteins tagged by GFP. Colocalization of
OxrA-GFP with a mitochondrial marker, as visualized by fluorescence microscopy; the merged yellow
color shows colocalization. (D) Colocalization of OxrA-GFP with MrsA-RFP is visualized by fluorescence
microscopy; the merged image (yellow) shows the high degree of colocalization. Scale bars, 10 m m.
corresponding native gene was complemented into the DoxrA mutant, the SJX02 ensuring
strains (OxrA reconstituted [OxrA-recon]) showed H2O2 susceptibility phenotypes similar to
that of the parental strain (Fig. 3A), indicating that the aberrant DoxrA H2O2 sensitivity phenotypes were specific to the loss of oxrA gene. Next, the effect of oxrA overexpression on
the susceptibility to H2O2 treatment was investigated, and we constructed a strain placing
OE::oxrA in the wild-type background. Our results showed that WTOE:: oxrA exhibited a similar H2O2 susceptibility profile to that of the parental strain (Fig. S3). To examine whether
OxrA was involved in responding to other oxidative stressors such as menadione, we
examined and compared menadione susceptibilities of the DoxrA mutant and its parental
strain. As a result, the DoxrA strain displayed similar susceptibility to menadione to the parental strain under the same culture conditions (Fig. S4), indicating that OxrA has a distinct
role in the response of A. fumigatus to oxidative stress generated by menadione and H2O2.
In order to examine the role of OxrA in response to the other stress conditions such as
thermal or salt stress, relevant experiments were conducted which revealed no significant
differences in response to thermal (42°C) and salt stress (0.8 M NaCl) between the constructed DoxrA mutant strain and the corresponding parental strain (data are not shown).
Collectively, the above findings indicated that OxrA mostly played a vital part in the
November 2021 Volume 87 Issue 22 e01120-21
aem.asm.org 5
Downloaded from https://journals.asm.org/journal/aem on 15 April 2022 by 184.177.74.2.
The Role of OxrA in Aspergillus fumigatus
Applied and Environmental Microbiology
FIG 3 Deletion of oxrA results in increased sensitivity to oxidative stress. (A) Comparison of H2O2 susceptibilities
in oxrA null mutant, oxrA-reconstituted mutant, and the parental wild-type A1160C (WT). Different strains were
inoculated as a series of 3-m l 10-fold dilutions derived from a starting suspension of 107 conidia per ml onto solid
YAG with or without H2O2 and cultured at 37°C for 2 days. (B) For comparison of the susceptibilities of the
indicated strains in liquid YAG supplemented with H2O2, amounts of 108 conidia of DoxrA mutant and the WT
were inoculated into 50 ml of liquid YAG supplemented with H2O2 and cultured at 37°C with shaking at 220 rpm
for 2 days. The cultures were poured into a new petri dish to be photographed. (C) Reactive oxygen species
(ROS) production of the parental wild-type strain, Doxr1 mutant, and Doxr1-recon. The ROS contents of Doxr1 and
Doxr1-recon were normalized to that of the parental wild type. The experiment was performed thrice with
biological triplicates. The data are presented as the means and standard deviations of three biological replicates.
Statistical analysis was performed using an unpaired two-tailed t test (**, P , 0.01). (D) Serially diluted conidia of
each strain were spotted onto YAG plates containing the ROS scavenger L-ascorbic acid sodium (Vc, 10 mM) and
H2O2 (5 mM). The plates were incubated at 37°C for 2 days.
oxidative stress response. Next, it was explored whether the observed hypersensitivity of
DoxrA to oxidative stress was due to an increased level of ROS. The 29,79-dichlorodihydrofluorescein diacetate (H2DCFDA) oxidant-sensing probe was employed to detect the ROS
contents, which were metabolized by the ROS into a highly fluorescent state. As presented
in Fig. 3C, the ROS production in DoxrA was significantly higher than in the parental strain
and the complemented strain, suggesting that higher intercellular ROS level in the tDoxrA
mutant may account for the increased sensitivity toward oxidative stress. To further test
the possible relationship between H2O2 hypersensitivity and the increased ROS level in the
DoxrA strain, antioxidant L-ascorbic acid sodium (Vc) was added to the medium. As shown
in Fig. 3D, compared to treatment with H2O2 only, L-ascorbic acid sodium (10 mM) almost
completely restored the colony phenotype of DoxrA to that of the parental wild-type strain
November 2021 Volume 87 Issue 22 e01120-21
aem.asm.org 6
Downloaded from https://journals.asm.org/journal/aem on 15 April 2022 by 184.177.74.2.
Zhai et al.
Applied and Environmental Microbiology
in the presence of H2O2. This suggests that the abnormal ROS level in the DoxrA mutant is
strongly related to its phenotype of hypersensitivity to oxidative stress.
OxrA contributes to oxidative stress resistance by regulating catalase function.
While OxrA is known to provide protection against oxidative stress in A. fumigatus, the
underlying mechanism remains unclear to date. Our results revealed that the increased
ROS contents in the DoxrA mutant might account for the increased sensitivity toward oxidative stress. Therefore, it was expected that the function of the ROS-scavenging proteins
might decrease in the DoxrA mutant. In eukaryotes, cells have evolved numerous mechanisms to scavenge ROS. For example, antioxidant enzymes such as superoxide dismutase
(SOD) and catalase (CAT) can scavenge ROS (35). SOD can convert superoxide anion into
H2O2, and CAT can detoxify H2O2 into water and oxygen. Therefore, it was hypothesized
that OxrA modulates these ROS-scavenging enzymes in A. fumigatus. In order to determine
the effect of OxrA on the activity of these ROS detoxification enzymes, the activity of SOD
and CAT was evaluated in the protein extracts isolated from the DoxrA strain, the parental
wild-type strain, and the corresponding complemented strain, and they revealed that the
total SOD activity in the DoxrA mutant was similar to that in the parental strain. However,
the total CAT activity was decreased significantly in the protein extracts isolated from the
DoxrA culture (Fig. 4A), and it was inferred that this reduced activity of the CAT antioxidant
enzyme was the possible reason for the enhanced sensitivity to oxidative stress. The next
question that arose was whether increasing the CAT activity in an overexpression experiment could rescue the phenotype associated with oxrA deficiency. In order to answer this,
the full-length ORF of catA/B controlled by the gpdA promoter was transformed into oxrA
deletion strain, yielding the strains SJX03 (DoxrAOE::catA) and SJX04 (DoxrAOE::catB). The results
of the analysis revealed that in the DoxrAOE::catB strain, the sensitivity to oxidative stress
could be restored to levels similar to those in the corresponding parental wild-type strain,
while the DOxrAOE::catA strain demonstrated a partial restoration of the oxidative stress sensitivity of the DoxrA strain (Fig. 4B). Next, we further measured catalase and SOD activity
in the DoxrAOE::catA and DoxrAOE::catB mutants. Our results showed that the total CAT activity
in the DoxrAOE::catA and DoxrAOE::catB mutants was slightly higher than that of the parental
strain (Fig. 4A). However, the total SOD activity in DoxrA, as well as DoxrAOE::catA and
DoxrAOE::catB mutants, was similar to that in the parental strain (Fig. 4A). Additionally, the
level of ROS in the DoxrAOE::catA and DoxrAOE::catB mutants could also be restored to levels
similar to that in the parental strain (Fig. 4C). Moreover, catA or catB overexpression in the
parental wild-type strain did not considerably enhance the oxidative stress sensitivity
under the tested conditions (Fig. 4B). Altogether, these data indicate that OxrA may be
required for the normal function of catalases during the regulation of ROS detoxification
and that multiple copies of CAT genes could suppress the defect of OxrA during
ROS detoxification. To further explore the molecular mechanism of OxrA regulating CAT
function, we initially analyzed and compared the transcription levels of catA/B genes by
reverse transcription-quantitative PCR (RT-PCR), using tubulin as a loading control. Our
results showed that the transcriptional level of catA/B genes was almost normal in the
oxrA deletion mutant compared to the level in the parental strain (Fig. S5). Next, we
analyzed the expression level of CatA/B proteins by Western blotting. Our results showed
that the protein expression level of CatB was also normal in the oxrA deletion mutant compared to the level in the parental strain (Fig. 4D). Interestingly, the molecular weight of
CatB in the DoxrA mutant was lower than that in the parental strain (Fig. 4D). In humans,
oxidation resistance 1 (Oxr1) can regulate posttranslational modifications of potent antioxidant enzymes (36). Thus, we speculate that the posttranslational modifications of CatB
might be one of the reasons for the decrease in the molecular weight of the DoxrA mutant. Unfortunately, we were unable to detect the CatA protein band by Western blotting
in this study. Taken together, these data suggest that OxrA might contribute to the regulation of the activity of catalases by regulating posttranslational modifications of CatB.
Hence, it is necessary to further study and confirm our hypothesis.
To further characterize the relationship between OxrA and catalases, we constructed DcatA, DcatB, DoxrA DcatA, and DoxrA DcatB mutants, and then examined and
November 2021 Volume 87 Issue 22 e01120-21
aem.asm.org 7
Downloaded from https://journals.asm.org/journal/aem on 15 April 2022 by 184.177.74.2.
The Role of OxrA in Aspergillus fumigatus
Applied and Environmental Microbiology
FIG 4 OxrA contributes to oxidative stress resistance by regulating catalase function. (A) Total SOD and CAT
activities quantified from the protein extracts of the YAG cultures. Conidia of different strains were inoculated
in liquid YAG and shaken at 37°C for 48 h, and then the proteins were extracted for enzymatic assays. The
experiment was performed thrice with biological triplicates. The data are presented as the means and standard
deviations of three biological replicates. Statistical analysis was performed using an unpaired two-tailed t test
(**, P , 0.01). (B) Susceptibility comparison of different strains on YAG plates supplemented with H2O2 as
described in the legend to Fig. 3. (C) Reactive oxygen species (ROS) production of the indicated strains. The
ROS contents of the indicated strains were normalized to that of the parental wild type. The experiment was
performed thrice with biological triplicates. The data are presented as the means and standard deviations of
three biological replicates. Statistical analysis was performed using an unpaired two-tailed t test (**, P , 0.01).
(D) Western blotting shows the protein expression of CatB in the DoxrA and the parental wild-type strains with
or without the addition of 5 mM H2O2, and the protein expression level of CatB was also normal in the oxrA
deletion mutant compared with the level in the parental strain. However, the molecular weight of CatB in
DoxrA mutant is smaller than that in the parental strain.
compared the oxidative stress susceptibilities of these mutants. Unlike the DoxrA mutant, which was supersensitive to H2O2, the DcatA mutant exhibited slightly increased
susceptibility to H2O2 compared to the susceptibility of the parental strain. However,
the DcatB mutant showed susceptibility profiles similar to that of the parental strain
(Fig. 5). Additionally, the DoxrA DcatA mutant was more susceptible to H2O2 than the
DoxrA mutant, suggesting that OxrA and CatA might cooperate to cope with H2O2
stress. To determine the relationship between OxrA and the SOD antioxidant enzyme,
as well as glutathione peroxidase (GPX), the strains SJX05 (DoxrAOE::sodA), SJX06
(DoxrAOE::sodB), and SJX07 (DoxrAOE::gpxA) were constructed through the transformation
of full-length sodA, sodB, and gpxA, respectively, controlled by the gpdA promoter into
November 2021 Volume 87 Issue 22 e01120-21
aem.asm.org 8
Downloaded from https://journals.asm.org/journal/aem on 15 April 2022 by 184.177.74.2.
Zhai et al.
The Role of OxrA in Aspergillus fumigatus
Applied and Environmental Microbiology
the oxrA deletion strain. The results demonstrated that the three constructed strains
(SJX05, SJX06, and SJX07) presented H2O2 susceptibility profiles similar to that of
the DoxrA strain (Fig. S6). Moreover, the total CAT activity and the level of ROS in
DoxrAOE::sodA/B and DoxrAOE::gpxA were also similar to that in the DoxrA mutant. In summary, these results suggested that OxrA contributes to oxidative stress resistance only
by promoting CAT function and not the function of the SOD and GPX enzymes.
OxrA deficiency decreased the virulence of A. fumigatus and altered the host
immune response. In the case of infection, ROS are generated in macrophages via the
NADPH oxidase route (37), which is an efficient approach to kill pathogenic A. fumigatus
(38, 39). Therefore, an effective ROS detoxification system plays an important role in A.
fumigatus survival in such adverse environments. As stated earlier, the present report
describes the involvement of OxrA in the oxidative stress resistance demonstrated by A.
fumigatus. In this context, a mouse model was used to test the virulence of the parental
wild-type strain, DoxrA strain, and the corresponding complemented strain. Conidia were
inoculated into each group of mice, while the mice in the control group were inoculated
with saline solution. The mice subjected to DoxrA mutant infection had a markedly
decreased virulence in comparison to the mice subjected to infection with the parental
wild-type strain, as revealed by the Kaplan-Meier log-rank analysis (P , 0.01) (Fig. 6A).
After 6 days, no mouse in the parental wild-type strain infection group survived, which
was significantly different from the survival rate of 100% observed with the mice infected
with the DoxrA mutant. Next, quantitative RT-PCR (qRT-PCR) analysis was conducted on
the 3rd and 4th days to examine the pulmonary fungal burdens. The mice that received
DoxrA mutant inoculation had markedly lower pulmonary fungal burden than those inoculated with the parental wild-type strain (Fig. 6B). To confirm whether the dead mice
were infected with A. fumigatus, histopathological examination of lung sections was carried out. Histopathological examinations by the Grocott’s methenamine silver nitrate
staining revealed that lung tissue from the parental wild-type-infected mice and
DoxrA-recon-infected mice displayed aggressive fungal growth, whereas lungs from
DoxrA-infected mice displayed fewer and shorter hyphae, indicating that the host
immune system could inhibit the growth of mycelia (Fig. 6C). Moreover, the albumin and
November 2021 Volume 87 Issue 22 e01120-21
aem.asm.org 9
Downloaded from https://journals.asm.org/journal/aem on 15 April 2022 by 184.177.74.2.
FIG 5 OxrA and CatA cooperate to cope with H2O2 stress. Comparison of the H2O2 susceptibilities of
the parental wild-type A1160C (WT), DcatA, DcatB, DoxrA DcatA, and DoxrA DcatB mutants. Different
strains were inoculated as a series of 3-m l 10-fold dilutions derived from a starting suspension of 107
conidia per ml on to solid YAG with or without 5 mM H2O2 and cultured at 37°C for 2 days, showing
that DoxrA DcatA mutant was more susceptible to H2O2 than the DoxrA mutant.
Applied and Environmental Microbiology
FIG 6 The DoxrA mutant is attenuated for virulence in mice in the cyclophosphamide and corticosteroid
mouse model. (A) The cyclophosphamide and corticosteroid mouse model was used for virulence analysis. The
mice were immunosuppressed as described in Materials and Methods, infected, and observed for mortality for
14 days. PBS was used for the mock infection control group. The mice infected by strain DoxrA displayed
attenuated virulence compared to those infected by the parental wild-type A1160C (WT) as determined by
Kaplan-Meier log-rank analysis (P , 0.01). (B) Decreased fungal burden in DoxrA-inoculated mice. To assess
fungal burden in lungs, the cyclophosphamide and corticosteroid model was utilized as described in Materials
and Methods. Mice were sacrificed on days 3 and 4 postinoculation. Fungal burden in the lungs was
determined by quantitative real-time PCR based on the 18S rRNA gene of A. fumigatus. Data are presented as
total fungal genomic DNA normalized to input DNA. The mean and standard error are presented (n = 3 mice
for the control group and n = 5 mice for inoculation groups). Statistical analysis was performed using
analysis of variance (ANOVA). Statistical significance was accepted at a P value of ,0.01. (C) Histopathological
analyses for related strains-infected lung tissues conducted using Grocott s methenamine silver nitrate (GMS)
staining. Scale bar, 50 m m. (D) Decreased levels of tissue damage in DoxrA-inoculated mice. LDH (lactate
dehydrogenase) and albumin release in bronchoalveolar (BAL) fluids in cyclophosphamide and corticosteroid
immunosuppressed mice were determined on days 3 and 4 postinfection in the WT-, DoxrA-, and DoxrA-recon
inoculated mice. Data are presented as the means and standard deviations of three biological replicates (*,
P , 0.05).
lactate dehydrogenase (LDH) levels in the bronchoalveolar lavage fluid (BALF) were measured to analyze the degree of tissue injury caused by the above three strains, respectively.
The mice inoculated with the DoxrA mutant exhibited significantly decreased levels of
LDH and albumin release on day 3 and day 4 postinoculation compared to the mice inoculated with the parental wild-type strain (Fig. 6D). Taken together, inoculation with the
DoxrA mutant resulted in decreased fungal burden along with mitigated tissue injury,
indicating that OxrA had a vital role in the pathogenic mechanism of invasive pulmonary
aspergillosis.
In order to better understand the mechanism underlying the lower virulence of the
DoxrA mutant, the cell inflammatory profiles in the airways were determined. First, the
November 2021 Volume 87 Issue 22 e01120-21
aem.asm.org
10
Downloaded from https://journals.asm.org/journal/aem on 15 April 2022 by 184.177.74.2.
Zhai et al.
The Role of OxrA in Aspergillus fumigatus
Applied and Environmental Microbiology
cellular infiltrates in the BAL fluids were analyzed using differential cell counts. The differential cell counts in BALF at day 3 after inoculation suggested that macrophages,
neutrophils in particular, significantly decreased in the DoxrA mutant-inoculated mice
(Fig. 7A), which indicated a decreased inflammatory response in the mice infected with
the DoxrA mutant. In order to quantify the different immune responses to the DoxrA
mutant, the cytokine contents related to the recruitment of neutrophils in mice (such
as MIP-2 and KC) were evaluated. It was revealed that the expression of cytokine KC
was significantly decreased in the mice inoculated with the DoxrA mutant compared
to the mice inoculated with the parental wild-type strain. However, the protein levels
of cytokines MIP-2 were slightly elevated compared to BALF in the mice inoculated
with the wild-type strain (Fig. 7B). Collectively, these findings indicated that, in the
process of A. fumigatus infection, OxrA possibly serves as a vital signal transduction
protein in A. fumigatus and is involved in the physiological processes of this fungus
and that a loss of OxrA affects the infection outcomes due to the modulation of the
innate immune response.
DISCUSSION
In the event of microbial infection, the host cells generate ROS to fight the invading
microbes, such as pathogenic bacteria, viruses, and fungi (2, 40–44). Therefore, an
effective ROS detoxification system plays a key role in the survival of the pathogen
under such adverse environments. The present study proposes that OxrA plays a vital
role in fungal pathogenic mechanism and ROS detoxification, which lays a certain molecular foundation for understanding the biological basis of oxidative stress response
November 2021 Volume 87 Issue 22 e01120-21
aem.asm.org
11
Downloaded from https://journals.asm.org/journal/aem on 15 April 2022 by 184.177.74.2.
FIG 7 OxrA deficiency alters the host immune response. (A) Characterization of cellular infiltrates in
bronchoalveolar (BAL) fluids. Differential cell counts demonstrate that macrophage numbers and
particularly neutrophil numbers were significantly decreased in mice inoculated with DoxrA mutant.
Results are presented as mean and standard error of n = 5 mice. (**, P , 0.01). The experiment was
repeated in duplicate with similar results. (B) Cytokine production in response to A. fumigatus, the
parental wild-type A1160C (WT), and DoxrA inoculation. KC and MIP-2 concentrations were
determined in BAL fluids on day 3 postinoculation. Significant differences between the parental wildtype A1160C and DoxrA inoculation groups could be observed for KC and MIP-2 protein levels.
Results are the mean and standard error of n = 5 mice. (*, P , 0.05).
Applied and Environmental Microbiology
in pathogenic fungi. The present study is, to the best of our knowledge, a pioneer in
reporting the vital role of Oxr1 protein in pathogenic fungi.
Intracellular ROS are produced mainly in the mitochondria (8), and therefore,
numerous proteins involved in the processes of compensating for the adverse effects
of ROS, including SOD, CAT, and GPX enzymes, are located in the mitochondria.
Despite the seeming overabundance of these ROS detoxification functions in A. fumigatus, the DoxrA mutant remains sensitive to oxidative stress (Fig. 3A), which indicates
that it plays a vital role in ROS scavenging. It is reported that the Oxr1 protein in
humans and yeasts belongs to the highly conserved eukaryotic protein family involved
in oxidative stress resistance (18). In A. fumigatus, the OxrA protein is located in the mitochondria and is involved in oxidative stress resistance (Fig. 2 and 3), which once
again confirms that the location and function of the Oxr1 protein are conservative in
eukaryotes.
Oxr1 is reported to be involved in oxidative stress resistance in several eukaryotes
(18, 24), although the precise mechanism underlying such protection is unclear, as the
mechanisms appear to be different in different organisms. For instance, in zebrafish,
Oxr1 regulates the expression of multiple antioxidant genes (i.e., gpx1b, gpx4a, gpx7,
and sod3a) involved in the detoxification of cellular ROS (17), while in Anopheles gambiae, Oxr1 regulates the levels of GPX and CAT, the enzymes related to H2O2 detoxification (24). The results of the present study confirmed that OxrA serves as an antioxidant
regulator in A. fumigatus and revealed the molecular mechanism of the OxrA-mediating oxidative stress resistance. As depicted in Fig. 4A, OxrA regulates the activity of
catalase, a protective enzyme associated with H2O2 detoxification, which illuminates
the mechanism of OxrA in A. fumigatus in a novel manner and corroborates the previous finding that the reduced activity of catalase antioxidant enzyme might be the reason for the increased sensitivity toward H2O2 in the DoxrA mutant. However, it was also
revealed that OxrA was not involved in regulating the expression of catA/B genes
encoding catalase (Fig. S5 in the supplemental material) and was not involved in regulating the expression of CatA/B proteins (Fig. 4D). However, OxrA contributes to regulation of the molecular weight of CatB, indicating that OxrA may regulate posttranslational modifications of CatB. Taken together, OxrA may contribute to regulation of
catalase activity by regulating posttranslational modifications of CatB. Of course, it is
necessary to further study and confirm our hypothesis. Furthermore, it was observed
that, unlike zebrafish and A. gambiae, OxrA was not involved in activating the transcription of glutathione peroxidase (Gpx) and SOD antioxidant enzyme genes (Fig. S5).
Moreover, the overexpression of GpxA, SodA, and SodB resulted in H2O2 sensitivity
comparable to that of the DoxrA strain (Fig. S6), indicating that OxrA might only be
regulating the catalase activity to affect the susceptibility of oxidative stress in A. fumigatus. Although there is evidence that Oxr1 provides protection against oxidative
stress by regulating catalase activity (as discussed above), Oxr1 itself is reported to
resist oxidative damage. A previous bioinformatics analysis confirmed that OxrA protein possesses a C-terminal TLDc domain with a high degree of conservation (Fig. 1).
Typically, the C-terminal TLDc domain of mouse/human Oxr1 is reported to resist oxidative stress by directly interacting with H2O2 via a conserved cysteine residue (22).
Another study reported that, in addition to the TLDc domain, the N-terminal domain in
human Oxr1 plays an important role in oxidative stress resistance (21). Therefore, Oxr1
itself is capable of preventing oxidative damage in mammals. In view of the structural
conservation of the Oxr1 protein in eukaryotes, it was hypothesized that the A. fumigatus OxrA may itself also prevent oxidative damage. Therefore, to reveal how the OxrA
protein participates in the oxidative stress resistance in A. fumigatus, further biochemical and molecular biological studies illustrating the structure and functions of OxrA are
necessary.
The ROS generated in the alveolar macrophages play an important role in the control over A. fumigatus conidia (39). An in vitro study examining the function of neutrophils revealed that H2O2 efficiently kills the A. fumigatus hyphae and that the addition
November 2021 Volume 87 Issue 22 e01120-21
aem.asm.org
12
Downloaded from https://journals.asm.org/journal/aem on 15 April 2022 by 184.177.74.2.
Zhai et al.
Applied and Environmental Microbiology
of commercial catalase could protect the neutrophils from damaging fungal hyphae
(45, 46). Furthermore, neutrophils from human patients with chronic granulomatous
disease (CGD) caused by mutations in the NADPH oxidase complex, where the phagocytes are unable to produce ROS, were reported to be incapable of killing the A. fumigatus hyphae (38). Collectively, the above findings indicate that the host-generated
ROS play an important role in killing A. fumigatus in vivo. Therefore, the ROS-scavenging proteins in A. fumigatus could be important virulence factors. The findings of the
present study suggested that the ROS-scavenging capacity is defective in the DoxrA
mutant and the OxrA deficiency significantly decreased the virulence of A. fumigatus,
indicating that the OxrA protein might be an important virulence factor (Fig. 6).
Indeed, the DoxrA mutant could not replicate in vitro or grow under oxidative stress
conditions that mimic the intracellular environment within the host, suggesting that
the markedly reduced ROS-scavenging ability of the DoxrA mutant fails to facilitate survival inside the phagosome with a high oxidative stress environment, causing the virulence of the DoxrA mutant within a mouse model (Fig. 6). The DoxrA strain is incapable
of growing under the intracellular environment of the host, and, therefore, the host
may mount an efficient immune response to eliminate the infection. Consistent with
our working hypothesis, the fungal load in DoxrA strain-infected mice was markedly
decreased compared to that in the parental strain-infected mice (Fig. 6B). Moreover,
the albumin and LDH assays revealed that the level of tissue damage in the mice
infected with DoxrA mutant was also reduced relative to the parental strain-infected
mice (Fig. 6D). As depicted in the inflammatory profile in Fig. 7, infection with the
OxrA-lacking A. fumigatus strain affected the recruitment of host cells and the generation of cytokines. Nonetheless, further investigation is warranted to elucidate the precise mechanisms underlying the regulation of OxrA in the A. fumigatus response within
the host cells.
One of the most important experimental factors with aspergillosis in the mouse
model is the immune status of the mice. Typically, the immunosuppressive regimens
used in mouse models for invasive aspergillosis (IA) rely on cyclophosphamide and/or
cortisone. Since the inhibitory effects of corticosteroids on the antifungal activities of
phagocytes may be less efficient in vivo, corticosteroid- and cyclophosphamide-treated
(CCT) mice are often used for virulence analysis of A. fumigatus mutants. Corticosteroidtreated (CT) or CCT models are selected for virulence analysis depending on the
observed phenotype of the fungal mutant. CCT models are often used for virulence analysis of oxidative stress mutants (9, 47–49). Thus, in this study, we chose CCT models to
analyze virulence of the oxrA mutant. However, cyclophosphamide can suppress neutrophils’ oxidative burst and reduce ROS production and release (50). Thus, if the mice are
immunosuppressed with cyclophosphamide and corticosteroid in this study, it is unlikely
the virulence defect of the oxrA mutant is due to the oxidative stress phenotype.
Moreover, it has been reported that catalases are not essential for the virulence of pathogenic fungi. For example, in A. fumigatus, although the conidial catalase CatA can protect
the spores against the deleterious effects of H2O2 in vitro, it does not play a role in protecting conidia against the oxidative burst of macrophages (51, 52). In another pathogenic fungus, C. albicans, the ectopic expression of catalase enhances resistance to
oxidative stress, and Dcat1 cells are more sensitive to neutrophil killing. However, catalase inactivation did not attenuate C. albicans virulence (53). Thus, although Oxr1 participates in H2O2 resistance by regulating catalase activity, the reason for the virulence
defect of DoxrA mutant may not be due to the oxidative stress phenotype. In this study,
in order to confirm whether the oxidative stress-sensitive phenotype of DoxrA mutant is
the main reason for the decrease of virulence, we tested this directly by using the
DoxrAOE::catA strain, which exhibits a similar oxidative stress-sensitive phenotype to wild
type. Our result showed that the DoxrAOE::catA strain had decreased virulence (Fig. S7),
suggesting that the decreased virulence for DoxrA mutant may be caused by other reasons rather than oxidative stress-sensitive phenotype. Moreover, there are an increasing
number of studies suggesting an apparent lack of importance of ROS-scavenging
November 2021 Volume 87 Issue 22 e01120-21
aem.asm.org
13
Downloaded from https://journals.asm.org/journal/aem on 15 April 2022 by 184.177.74.2.
The Role of OxrA in Aspergillus fumigatus
Zhai et al.
Applied and Environmental Microbiology
TABLE 1 Aspergillus fumigatus strains used in this study
Genotype
DKU80 pyrG1
DKU80 pyrG, pyr4
DKU80 pyrG1, DoxrA::pyr4
DKU80 pyrG1, DoxrA::pyr4; oxrA (p)::oxrA::hph
DKU80 pyrG1, DoxrA::pyr4; gpd (p)::catA::hph
DKU80 pyrG1, DoxrA::pyr4; gpd (p)::catB::hph
DKU80 pyrG1, DoxrA::pyr4; gpd (p)::sodA::hph
DKU80 pyrG1, DoxrA::pyr4; gpd (p)::sodB::hph
DKU80 pyrG1, DoxrA::pyr4; gpd (p)::gpxA::hph
Source
FGSC
This study
This study
This study
This study
This study
This study
This study
This study
mechanisms to control A. fumigatus virulence. Such data came out of the analysis of
other A. fumigatus mutants, such as Dcat mutants lacking either conidial or mycelial catalases and Dsod and Dyap1 mutants, where the hypersensitivity to H2O2 observed in vitro
is not correlated with a reduction of fungal virulence in an experimental model of aspergillosis. Thus, non-ROS-scavenging mechanisms of OxrA might play a major role in the
virulence of A. fumigatus. As the cell wall and virulence phenotypes share a striking correlation and a number of cell wall mutants have been found that are reduced in virulence, we tested the susceptibility of DoxrA mutant to wall-perturbing agents. Our results
showed that DoxrA mutant exhibited slightly increased susceptibility to wall-perturbing
agents SDS, calcofluor white (CFW), and Congo red (CR) (Fig. S8). Thus, we speculate that
the phenotypes that correlate best with the decrease in virulence for DoxrA mutant are
their cell wall defects. One explanation for the reduced virulence in some cell wall
mutants is increased “unmasking” of b -1,3-glucan and greater immune response from
the host. It is possible that this may be the case for the DoxrA mutant, but this remains
to be tested. Alternatively, the DoxrA mutant may have defects in the cell wall that somehow compromise its ability to grow in the host.
ROS production is a central element of the host immune response, and a severe hereditary defect such as CGD represents a high risk for IA. Although non-ROS-scavenging
mechanisms of OxrA play a major role in the virulence of A. fumigatus in the corticosteroid- and cyclophosphamide-treated mice model, this kind of immune suppression
mimics neutropenia, i.e., results in the absence of any relevant functional immune cells.
Moreover, cyclophosphamide also can suppress neutrophil oxidative burst and reduce
ROS production and release if the mice are neutropenic, as is the case with mice immunosuppressed with corticosteroid and cyclophosphamide. OxrA may not be as important
for A. fumigatus to survive inside the host, and therefore, in order to further investigate
the role of OxrA during infection, we further analyzed virulence of DoxrA mutant in a
nonneutropenic (cortisone model) mouse model. In this study, we found that the DoxrA
mutant is significantly less virulent than the wild type (Fig. S9), indicating that the fungal
ROS hypersensitivity contributed to reduced virulence. This conclusion is consistent with
ROS-mediated damage being attributed to the killing capacity of innate immune cells.
Therefore, it will be interesting to further elucidate the role of OxrA in host-pathogen
interactions. Future research may consider targeting the OxrA activity for therapeutic
purposes.
MATERIALS AND METHODS
Strains and culture conditions. All strains used in this study are described in Table 1. A. fumigatus
strain 1160 was purchased from the Fungal Genetics Stock Center (FGSC) and was used to generate
DoxrA null mutant strain. The media used in this study included YAG (2% glucose, 0.5% yeast extract,
and trace elements), MM (1% glucose, trace elements, and salts), and 100 ml trace elements (2.20 g
ZnSO47H2O, 1.10 g H3BO3, 0.50 g MnCl24H2O, 0.16 g FeSO47H2O, 0.16 g CoCl25H2O, 0.16 g
CuSO45H2O, 0.11 g (NH4)6Mo7O244H2O, and 5.00 g Na4EDTA). A. fumigatus strain A1160 was cultured on
YUU (0.5% yeast extract, 2% dextrose, trace minerals,1.2% uracil, and 1.1% uridine) at 37°C. Conidia were
harvested and collected from plates with 48 h of incubation at 37°C. Next, conidia were diluted and
counted in a Neubauer chamber.
November 2021 Volume 87 Issue 22 e01120-21
aem.asm.org
14
Downloaded from https://journals.asm.org/journal/aem on 15 April 2022 by 184.177.74.2.
Strain
A1160
A1160C
SJX01
SJX02
SJX03
SJX04
SJX05
SJX06
SJX07
The Role of OxrA in Aspergillus fumigatus
Applied and Environmental Microbiology
TABLE 2 Primers used in this study
Sequence(s) (59–39)
ACCGAGAAGGAGCGCGGGAG
TGTCTGACGGACCAGCGGTC
GGCTTGTCTGCTCCCGCAGCGATGGGAAGAGATTCA
ACGCCAGGGTTTTCCCGTTTGAGGAAAGGAAC
AGCCCATTTCGTTCACTCCG
AGCCTCGCCGTTTGGGTC
GGCCGATCCTCCGGCCGAGG
AATGAACGCCAGAAACAACC
GGACGATGAGCACGTAGCC
GGATTGGGAAAGTTGAGAGG
AGCGCCACTCAAGTCCGTACAGCATACATTACATATTTT
GTGTTGAGTCTCAGGAGA
CGGAGCAGACAAGCC
GGGAAAACCCTGGCGT
Construction of the A. fumigatus strains. Fusion PCR was used to construct the oxrA knockout cassette as previously described. In brief, approximately 1-kb sections of regions flanking the oxrA gene
were amplified using the primers P1/P3 and P4/P6. The selection marker pyr4 from the plasmid pAL5
was amplified with the primers Pyr4 F/R. Next, the three PCR products were used as the template to
generate the oxrA deletion cassette using the primers P2/P5 and then transformed into the parental
A. fumigatus strain A1160 as previously described. Transformants were verified by diagnostic PCR using
the primers P8/P9, P1/P7, and P6/P10, respectively.
To complement the DoxrA strain, the cassette containing the oxrA gene plus the two 1.5-kb flanking
regions was PCR amplified using primers P11/P12. This fragment was subsequently cloned into the
pAN7-1 plasmid, which contains the hygromycin B resistance gene hph, to generate the oxrA complementation plasmid. The plasmid was then transformed into the oxrA deletion strain, and transformants
were selected on YAG medium supplemented with 200 m g/ml hygromycin. The primers used in this
study are shown in Table 2.
To overexpress OxrA in the parental strain, a 1.1-kb DNA fragment, including the oxrA coding
sequence, was PCR amplified and cloned into the plasmid pBARGPE, which contains a gpd promoter.
Strain SJX03 (WTOE::oxrA) was generated by transforming the plasmid into the parental strain. The transformants were screened on MM containing 200 m g/ml of hygromycin B. The same method was used to
generate strains SJX04 (DoxrAOE::catA), SJX05 (DoxrAOE::catB), SJX06 (DoxrAOE::sodA), SJX07 (DoxrAOE::sodB), and
SJX08 (DoxrAOE::gpxA).
Since strain A1160 harbors a nonfunctional pyrG gene and cannot be used in animal infection models as a wild type, the Neurospora crassa pyr4 gene was complemented into the strain A1160. To construct the strain A1160 harboring a functional pyr4 gene, the pyr4 gene was amplified from the pAL5
plasmid using the primer pair Pyr4F/4R. The PCR product was cloned into the pEASY-Blunt Zero cloning
kit (TransGen Biotech) and used to transform the recipient strain A1160, yielding the strain A1160C,
which harbors a functional pyr4 gene.
Light microscopy. To visualize localization of OxrA-GFP, conidia were incubated in 2 ml of liquid
MM on coverslips at 37°C for 12 h. After that, the medium was removed from the culture dish and
washed by phosphate-buffered saline (PBS) at least three times, and then the prewarmed (37°C) staining
solution containing MitoTracker Red CMXRos probe (working concentration, 25 nM) was added and
incubated for 5 min under growth conditions. After straining was complete, the staining solution was
removed and washed with PBS, and cells were observed using a fluorescence microscope. All images
were captured using the Axio Imager A1 fluorescence microscope (Carl Zeiss, Jena, Germany).
Measurement of reactive oxygen species. We incubated 107 spores in 100 ml YAG media at 37°C
for 18 h with shaking at 220 rpm. Then, 20 m M 29,79-dichlorodihydrofluorescein diacetate (H2DCFDA;
Invitrogen) was added to the medium and incubated at 37°C for 1 h. After that, the mycelia were harvested and washed three times with the distilled water to remove extracellular H2DCFDA. The filtered
mycelia were then ground in liquid nitrogen and suspended in PBS. The resulting supernatant was collected by centrifugation at 15,000 g and 4°C for 10 min. Fluorescence was measured using a
SpectraMax M2 reader (Molecular Devices, USA), with an excitation wavelength of 504 nm and an emission wavelength of 524 nm. The fluorescence intensity was normalized to the protein concentration of
the sample, which was measured using a Bio-Rad protein assay kit.
RNA extraction and RT-PCR. Total RNA from the spores cultured in liquid YAG at 37°C and 200 rpm
for 48 h was extracted using the TRIzol reagent (Invitrogen). One hundred milligrams of mycelia per
sample was used as the starting material for the determination of total RNA. cDNA synthesis was performed with 1.5 m g of RNA using HiScript Q RT SuperMix (Vazyme; catalog no. R123-01), and then cDNA
was used for the real-time analysis. Real-time PCRs were performed in triplicates, and the expression levels of all genes of interest were normalized to b -tubulin levels. The threshold cycle (DDCT) method of
analysis was used to determine fold changes of gene expression in the DOxrA mutant relative to the
wild-type 1160 strain.
November 2021 Volume 87 Issue 22 e01120-21
aem.asm.org
15
Downloaded from https://journals.asm.org/journal/aem on 15 April 2022 by 184.177.74.2.
Primer name
P1
P2
P3
P4
P5
P6
P7
P8
P9
P10
P11
P12
Pyr4 F
Pyr4 R
Applied and Environmental Microbiology
Enzyme activity assay. Briefly, 1 106 conidia of DoxrA, the parental wild type, and the corresponding complemented strains were inoculated in liquid YAG and shaken at 37°C for 48 h. The mycelia were
harvested and ground in liquid nitrogen and suspended in ice-cold extraction buffer (50 mM HEPES [pH
7.4], 137 mM KCl, 10% glycerol, 1 mM EDTA, 1 m g/ml pepstatin A, 1 m g/ml leupeptin, and 1 mM phenylmethylsulfonyl fluoride [PMSF]). After centrifugation, the supernatants were used for enzymatic assays.
Protein concentrations were determined by using a Bradford protein assay kit (Sangon Biotech, China).
Catalase activity and superoxide dismutase activity were quantified using commercial assay kits
(Beyotime Biotechnology, China).
Virulence assay. The immunocompromised mouse model for invasive pulmonary aspergillosis was
described previously (54). Briefly, the virulence of the A. fumigatus strains was tested in two immunologically distinct murine models of invasive pulmonary aspergillosis. For the corticosteroid model, white
female ICR mice (6 to 8 weeks old, 22 to 25 g) were immunosuppressed with a single dose of hydrocortisone acetate injected subcutaneously (s.c.) at 40 mg/kg 1 day prior to inoculation. For the cyclophosphamide and corticosteroid model, mice were given intraperitoneal injections of cyclophosphamide
(150 mg/kg of body weight) on days 3 and 1 relative to infection and a subcutaneous injection of hydrocortisone acetate (40 mg/kg of body weight) on day 1. Bacterial infections were prevented by adding
2 g/liter neomycin to the drinking water. Infection inoculum was prepared by growing the A. fumigatus
isolates on YAG agar plates at 37°C for 3 days. Conidia were harvested by washing the plate surface with
sterile phosphate-buffered saline-0.01% Tween 80. The resultant conidial suspension was adjusted to
the desired concentration by hemacytometer count. On day 0, mice were anesthetized with pentobarbital sodium. For survival studies, 10 mice were intranasally infected with 1 108 conidia of the A. fumigatus wild-type or DoxrA strain in 40 m l of sterile PBS. Cyclophosphamide (75 mg/kg) was injected every
3 days to maintain immunosuppression. The mortality was monitored during 14 days in total after inoculation. Differences in survival between experimental groups were compared using the log-rank test.
Statistical analysis of survival was performed using Kaplan-Meier log-rank analysis.
To assess fungal burden in lungs, the cyclophosphamide and corticosteroid model was utilized as
described above. Mice were sacrificed on days 3 and 4 postinoculation, and lungs were harvested and
immediately frozen in liquid nitrogen. Samples were freeze-dried and homogenized with glass beads on
a Mini-Beadbeater (BioSpec Products, Inc., Bartlesville, OK, USA), and DNA was extracted with the
E.N.Z.A. fungal DNA kit (Omega BioTek, Norcross, GA, USA).
For histopathology, the cyclophosphamide and corticosteroid model was utilized as described
above, and mice were sacrificed on day 3 postinoculation. When mice were sacrificed, lungs were
removed on that day. Lung tissue was fixed in 10% phosphate-buffered formalin. Pathological lung tissues were strained by Grocott’s methenamine silver nitrate by using standard histological techniques. A
total of 3 mice were examined.
For evaluation of pulmonary infiltrate, the cyclophosphamide and corticosteroid model was utilized
as described above; after 3 days of incubation, 5 infected mice were euthanized with a solution of
180 mg/kg of body weight of ketamine and 24 mg/kg of xylazine. Subsequently, bronchoalveolar lavage
(BAL) fluid was harvested by washing the lungs twice with 2 ml of PBS. Fluid was centrifuged, and cell
pellets were used for differential cell counts. Supernatants were used for cytokine quantification.
For determination of lactate dehydrogenase (LDH) and albumin levels in BAL fluids, the cyclophosphamide and corticosteroid model was utilized as described above, and mice were sacrificed on days 3
and 4 postinoculation. In vivo lung tissue damage was determined by measurement of LDH and albumin
levels in mouse BAL fluid samples by using an LDH assay (CytoTox 96 nonradioactive cytotoxicity assay,
Promega, Madison, WI, USA) and an albumin assay (albumin [BCG] reagent set; Eagle Diagnostics, Cedar
Hill, TX, USA) according to the manufacturers’ instructions.
SUPPLEMENTAL MATERIAL
Supplemental material is available online only.
SUPPLEMENTAL FILE 1, PDF file, 0.7 MB.
ACKNOWLEDGMENTS
This work was financially supported by the National Natural Science Foundation of
China (NSFC31800058 to J.S. and NSFC81703569 and 81870005 to R.L.).
REFERENCES
1. Pianalto KM, Alspaugh JA. 2016. New horizons in antifungal therapy. J
Fungi (Basel) 2:26. https://doi.org/10.3390/jof2040026.
2. Dantas AdS, Day A, Ikeh M, Kos I, Achan B, Quinn J. 2015. Oxidative stress
responses in the human fungal pathogen, Candida albicans. Biomolecules
5:142–165. https://doi.org/10.3390/biom5010142.
3. Song J, Zhou J, Zhang L, Li R. 2020. Mitochondria-mediated azole drug resistance and fungal pathogenicity: opportunities for therapeutic development.
Microorganisms 8:1574. https://doi.org/10.3390/microorganisms8101574.
4. Song J, Li R, Jiang J. 2019. Copper homeostasis in Aspergillus fumigatus:
opportunities for therapeutic development. Front Microbiol 10:774. https://
doi.org/10.3389/fmicb.2019.00774.
November 2021 Volume 87 Issue 22 e01120-21
5. Checa J, Aran JM. 2020. Airway redox homeostasis and inflammation
gone awry: from molecular pathogenesis to emerging therapeutics in respiratory pathology. Int J Mol Sci 21:9317. https://doi.org/10.3390/
ijms21239317.
6. Halliwell B. 2007. Oxidative stress and cancer: have we moved forward?
Biochem J 401:1–11. https://doi.org/10.1042/BJ20061131.
7. Phillips AJ, Sudbery I, Ramsdale M. 2003. Apoptosis induced by environmental stresses and amphotericin B in Candida albicans. Proc Natl Acad
Sci U S A 100:14327–14332. https://doi.org/10.1073/pnas.2332326100.
aem.asm.org
16
Downloaded from https://journals.asm.org/journal/aem on 15 April 2022 by 184.177.74.2.
Zhai et al.
8. Liu YB, Fiskum G, Schubert D. 2002. Generation of reactive oxygen species
by the mitochondrial electron transport chain. J Neurochem 80:780–787.
https://doi.org/10.1046/j.0022-3042.2002.00744.x.
9. Lambou K, Lamarre C, Beau R, Dufour N, Latge JP. 2010. Functional analysis of the superoxide dismutase family in Aspergillus fumigatus. Mol
Microbiol 75:910–923. https://doi.org/10.1111/j.1365-2958.2009.07024.x.
10. Medina-Gomez H, Farriols M, Santos F, Gonzalez-Hernandez A, TorresGuzman JC, Lanz H, Contreras-Garduno J. 2018. Pathogen-produced catalase affects immune priming: a potential pathogen strategy. Microb
Pathog 125:93–95. https://doi.org/10.1016/j.micpath.2018.09.012.
11. Li C, Shi L, Chen D, Ren A, Gao T, Zhao M. 2015. Functional analysis of the
role of glutathione peroxidase (GPx) in the ROS signaling pathway,
hyphal branching and the regulation of ganoderic acid biosynthesis in
Ganoderma lucidum. Fungal Genet Biol 82:168–180. https://doi.org/10
.1016/j.fgb.2015.07.008.
12. Hwang CS, Baek YU, Yim HS, Kang SO. 2003. Protective roles of mitochondrial manganese-containing superoxide dismutase against various stresses
in Candida albicans. Yeast 20:929–941. https://doi.org/10.1002/yea.1004.
13. Fradin C, De Groot P, MacCallum D, Schaller M, Klis F, Odds FC, Hube B.
2005. Granulocytes govern the transcriptional response, morphology and
proliferation of Candida albicans in human blood. Mol Microbiol 56:
397–415. https://doi.org/10.1111/j.1365-2958.2005.04557.x.
14. Enjalbert B, MacCallum DM, Odds FC, Brown AJ. 2007. Niche-specific activation of the oxidative stress response by the pathogenic fungus Candida albicans. Infect Immun 75:2143–2151. https://doi.org/10.1128/IAI.01680-06.
15. Hwang CS, Rhie GE, Oh JH, Huh WK, Yim HS, Kang SO. 2002. Copper- and
zinc-containing superoxide dismutase (Cu/ZnSOD) is required for the protection of Candida albicans against oxidative stresses and the expression
of its full virulence. Microbiology (Reading) 148:3705–3713. https://doi
.org/10.1099/00221287-148-11-3705.
16. Martchenko M, Alarco AM, Harcus D, Whiteway M. 2004. Superoxide dismutases in Candida albicans: transcriptional regulation and functional
characterization of the hyphal-induced SOD5 gene. Mol Biol Cell 15:
456–467. https://doi.org/10.1091/mbc.e03-03-0179.
17. Xu H, Jiang Y, Li S, Xie L, Tao YX, Li Y. 2020. Zebrafish Oxr1a knockout
reveals its role in regulating antioxidant defenses and aging. Genes 11:
1118. https://doi.org/10.3390/genes11101118.
18. Elliott NA, Volkert MR. 2004. Stress induction and mitochondrial localization of Oxr1 proteins in yeast and humans. Mol Cell Biol 24:3180–3187.
https://doi.org/10.1128/MCB.24.8.3180-3187.2004.
19. Zhang X, Zhang SP, Liu XG, Wang YY, Chang JH, Zhang X, Mackintosh SG,
Tackett AJ, He YH, Lv DW, Laberge RM, Campisi J, Wang JR, Zheng GR,
Zhou DH. 2018. Oxidation resistance 1 is a novel senolytic target. Aging
Cell 17:e12780. https://doi.org/10.1111/acel.12780.
20. Volkert MR, Elliott NA, Housman DE. 2000. Functional genomics reveals a
family of eukaryotic oxidation protection genes. Proc Natl Acad Sci U S A
97:14530–14535. https://doi.org/10.1073/pnas.260495897.
21. Sanada Y, Asai S, Ikemoto A, Moriwaki T, Nakamura N, Miyaji M, ZhangAkiyama QM. 2014. Oxidation resistance 1 is essential for protection
against oxidative stress and participates in the regulation of aging in Caenorhabditis elegans. Free Radic Res 48:919–928. https://doi.org/10.3109/
10715762.2014.927063.
22. Oliver PL, Finelli MJ, Edwards B, Bitoun E, Butts DL, Becker EBE, Cheeseman
MT, Davies B, Davies KE. 2011. Oxr1 is essential for protection against oxidative stress-induced neurodegeneration. PLoS Genet 7:e1002338. https://
doi.org/10.1371/journal.pgen.1002338.
23. Wu YX, Davies KE, Oliver PL. 2016. The antioxidant protein Oxr1 influences aspects of mitochondrial morphology. Free Radic Biol Med 95:
255–267. https://doi.org/10.1016/j.freeradbiomed.2016.03.029.
24. Jaramillo-Gutierrez G, Molina-Cruz A, Kumar S, Barillas-Mury C. 2010. The
Anopheles gambiae oxidation resistance 1 (OXR1) gene regulates expression of enzymes that detoxify reactive oxygen species. PLoS One 5:
e11168. https://doi.org/10.1371/journal.pone.0011168.
25. Kobayashi N, Takahashi M, Kihara S, Niimi T, Yamashita O, Yaginuma T.
2014. Cloning of cDNA encoding a Bombyx mori homolog of human oxidation resistance 1 (OXR1) protein from diapause eggs, and analyses of
its expression and function. J Insect Physiol 68:58–68. https://doi.org/10
.1016/j.jinsphys.2014.06.020.
26. Yang MY, Luna L, Sorbo JG, Alseth I, Johansen RE, Backe PH, Danbolt NC,
Eide L, Bjoras M. 2014. Human OXR1 maintains mitochondrial DNA integrity and counteracts hydrogen peroxide-induced oxidative stress by regulating antioxidant pathways involving p21. Free Radic Biol Med 77:41–48.
https://doi.org/10.1016/j.freeradbiomed.2014.09.003.
November 2021 Volume 87 Issue 22 e01120-21
Applied and Environmental Microbiology
27. Su LD, Zhang QL, Lu ZQ. 2017. Oxidation resistance 1 (OXR1) participates
in silkworm defense against bacterial infection through the JNK pathway.
Insect Sci 24:17–26. https://doi.org/10.1111/1744-7917.12285.
28. Matsui A, Kobayashi J, Kanno SI, Hashiguchi K, Miyaji M, Yoshikawa Y,
Yasui A, Zhang-Akiyama QM. 2020. Oxidation resistance 1 prevents genome instability through maintenance of G2/M arrest in gamma-ray-irradiated cells. J Radiat Res 61:1–13. https://doi.org/10.1093/jrr/rrz080.
29. Wang ZP, Berkey CD, Watnick PI. 2012. The Drosophila protein mustard
tailors the innate immune response activated by the immune deficiency
pathway. J Immunol 188:3993–4000. https://doi.org/10.4049/jimmunol
.1103301.
30. Yang MY, Lin XL, Rowe A, Rognes T, Eide L, Bjoras M. 2015. Transcriptome
analysis of human OXR1 depleted cells reveals its role in regulating the p53
signaling pathway. Sci Rep 5:17409. https://doi.org/10.1038/srep17409.
31. Finelli MJ, Oliver PL. 2017. TLDc proteins: new players in the oxidative
stress response and neurological disease. Mamm Genome 28:395–406.
https://doi.org/10.1007/s00335-017-9706-7.
32. Claros MG, Vincens P. 1996. Computational method to predict mitochondrially imported proteins and their targeting sequences. Eur J Biochem 241:779–786. https://doi.org/10.1111/j.1432-1033.1996.00779.x.
33. Long N, Xu X, Qian H, Zhang S, Lu L. 2016. A putative mitochondrial iron
transporter MrsA in Aspergillus fumigatus plays important roles in azole-,
oxidative stress responses and virulence. Front Microbiol 7:716. https://
doi.org/10.3389/fmicb.2016.00716.
34. Zhang YW, Wei WF, Fan JL, Jin C, Lu L, Fang WX. 2020. Aspergillus fumigatus mitochondrial acetyl coenzyme A acetyltransferase as an antifungal
target. Appl Environ Microbiol 86:e02986-19. https://doi.org/10.1128/
AEM.02986-19.
35. Sugui JA, Kim HS, Zarember KA, Chang YC, Gallin JI, Nierman WC, KwonChung KJ. 2008. Genes differentially expressed in conidia and hyphae of
Aspergillus fumigatus upon exposure to human neutrophils. PLoS One 3:
e2655. https://doi.org/10.1371/journal.pone.0002655.
36. Svistunova DM, Simon JN, Rembeza E, Crabtree M, Yue WW, Oliver PL,
Finelli MJ. 2019. Oxidation resistance 1 regulates post-translational modifications of peroxiredoxin 2 in the cerebellum. Free Radic Biol Med 130:
151–162. https://doi.org/10.1016/j.freeradbiomed.2018.10.447.
37. Babior BM. 2004. NADPH oxidase. Curr Opin Immunol 16:42–47. https://
doi.org/10.1016/j.coi.2003.12.001.
38. Almyroudis NG, Holland SM, Segal BH. 2005. Invasive aspergillosis in primary immunodeficiencies. Med Mycol 43(Suppl 1):S247–59. https://doi
.org/10.1080/13693780400025203.
39. Philippe B, Ibrahim-Granet O, Prevost MC, Gougerot-Pocidalo MA, Perez
AS, Van der Meeren A, Latge JP. 2003. Killing of Aspergillus fumigatus by
alveolar macrophages is mediated by reactive oxidant intermediates.
Infect Immun 71:3034–3042. https://doi.org/10.1128/IAI.71.6.3034-3042
.2003.
40. Ha EM, Oh CT, Ryu JH, Bae YS, Kang SW, Jang IH, Brey PT, Lee WJ. 2005. An
antioxidant system required for host protection against gut infection in
Drosophila. Dev Cell 8:125–132. https://doi.org/10.1016/j.devcel.2004.11
.007.
41. Zhang L, Lu Z. 2015. Expression, purification and characterization of an
atypical 2-Cys peroxiredoxin from the silkworm, Bombyx mori. Insect Mol
Biol 24:203–212. https://doi.org/10.1111/imb.12149.
42. Zhang Y, Lu Z. 2015. Peroxiredoxin 1 protects the pea aphid Acyrthosiphon
pisum from oxidative stress induced by Micrococcus luteus infection. J
Invertebr Pathol 127:115–121. https://doi.org/10.1016/j.jip.2015.03.011.
43. Pan X, Zhou G, Wu J, Bian G, Lu P, Raikhel AS, Xi Z. 2012. Wolbachia induces reactive oxygen species (ROS)-dependent activation of the Toll pathway to control dengue virus in the mosquito Aedes aegypti. Proc Natl
Acad Sci U S A 109:E23–31. https://doi.org/10.1073/pnas.1116932108.
44. Wong ZS, Brownlie JC, Johnson KN. 2015. Oxidative stress correlates with
Wolbachia-mediated antiviral protection in Wolbachia-Drosophila associations. Appl Environ Microbiol 81:3001–3005. https://doi.org/10.1128/
AEM.03847-14.
45. Diamond RD, Clark RA. 1982. Damage to Aspergillus fumigatus and Rhizopus oryzae hyphae by oxidative and nonoxidative microbicidal products
of human neutrophils in vitro. Infect Immun 38:487–495. https://doi.org/
10.1128/iai.38.2.487-495.1982.
46. Diamond RD, Krzesicki R, Epstein B, Jao W. 1978. Damage to hyphal forms
of fungi by human leukocytes in vitro. A possible host defense mechanism in aspergillosis and mucormycosis. Am J Pathol 91:313–328.
47. Lessing F, Kniemeyer O, Wozniok I, Loeffler J, Kurzai O, Haertl A, Brakhage
AA. 2007. The Aspergillus fumigatus transcriptional regulator AfYap1 represents the major regulator for defense against reactive oxygen
aem.asm.org
17
Downloaded from https://journals.asm.org/journal/aem on 15 April 2022 by 184.177.74.2.
The Role of OxrA in Aspergillus fumigatus
intermediates but is dispensable for pathogenicity in an intranasal mouse
infection model. Eukaryot Cell 6:2290–2302. https://doi.org/10.1128/EC
.00267-07.
48. Qiao JJ, Kontoyiannis DP, Calderone R, Li DM, Ma Y, Wan Z, Li RY, Liu W. 2008.
Afyap1, encoding a bZip transcriptional factor of Aspergillus fumigatus, contributes to oxidative stress response but is not essential to the virulence of this
pathogen in mice immunosuppressed by cyclophosphamide and triamcinolone. Med Mycol 46:773–782. https://doi.org/10.1080/13693780802054215.
49. Wang D, Wang S, He D, Gao S, Xue B, Wang L. 2016. Deletion of afpab1
causes increased sensitivity to oxidative stress and hypovirulence in Aspergillus fumigatus. Int J Mol Sci 17:1811. https://doi.org/10.3390/ijms17111811.
50. Hirsh M, Carmel J, Kaplan V, Livne E, Krausz MM. 2004. Activity of lung
neutrophils and matrix metalloproteinases in cyclophosphamide-treated
mice with experimental sepsis. Int J Exp Pathol 85:147–157. https://doi
.org/10.1111/j.0959-9673.2004.00385.x.
November 2021 Volume 87 Issue 22 e01120-21
Applied and Environmental Microbiology
51. Paris S, Wysong D, Debeaupuis JP, Shibuya K, Philippe B, Diamond RD, Latge
JP. 2003. Catalases of Aspergillus fumigatus. Infect Immun 71:3551–3562.
https://doi.org/10.1128/IAI.71.6.3551-3562.2003.
52. Shibuya K, Paris S, Ando T, Nakayama H, Hatori T, Latge JP. 2006. Catalases
of Aspergillus fumigatus and inflammation in aspergillosis. Nihon Ishinkin
Gakkai Zasshi 47:249–255. https://doi.org/10.3314/jjmm.47.249.
53. Pradhan A, Herrero-De-Dios C, Belmonte R, Budge S, Garcia AL, Kolmogorova
A, Lee KK, Martin BD, Ribeiro A, Bebes A, Yuecel R, Gow NAR, Munro CA,
MacCallum DM, Quinn J, Brown AJP. 2017. Elevated catalase expression in a
fungal pathogen is a double-edged sword of iron. PLoS Pathog 13:e1006405.
https://doi.org/10.1371/journal.ppat.1006405.
54. Song J, Zhai P, Zhang Y, Zhang C, Sang H, Han G, Keller NP, Lu L. 2016. The
Aspergillus fumigatus damage resistance protein family coordinately regulates ergosterol biosynthesis and azole susceptibility. mBio 7:e01919-15.
https://doi.org/10.1128/mBio.01919-15.
aem.asm.org
18
Downloaded from https://journals.asm.org/journal/aem on 15 April 2022 by 184.177.74.2.
Zhai et al.
Order an Essay Now & Get These Features For Free:
Turnitin Report
Formatting
Title Page
Citation
Outline
