1. In aliens the inability to digest carbon is an autosomal recessive trait. The ability todigest carbon is dominant. If a female that can digest carbon, with a father that couldnot digest carbon, has an offspring with a male that cannot digest, what is theprobability that:a. Their offspring will be able to digest carbon.
b. Their offspring will not be able to digest carbon.
c. What is/are the possible genotype(s) of the mother?
2. In a special type of squirrels black spots is dominant over no spots. A fluffy tail isdominant over a smooth tail. A squirrel with no spots and that is homozygous dominantfor a fluffy tail is mated with the squirrel that is heterozygous for both black spots and afluffy tail. Please give the genotypic and phenotypic ratio for this problem and show yourwork. 3. Below is a strand of DNA. Transcribe and translate it correctly like we did in class(pretend you are the ribosome)!
3’promoterTTGGCATACTTGGACGGGCCCTATAAAATTGCGATC
5’ AACCGTATGAACCTGGGCGGGATATTTTAACGCTAG
Order an Essay Now & Get These Features For Free:
Turnitin Report
Formatting
Title Page
Citation
Outline
